Estrogen Receptor 1(ESR1) (NM_000125) Human Untagged Clone

CAT#: SC125287

ESR1 (untagged)-Human estrogen receptor 1 (ESR1), transcript variant 1

USD 721.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Estrogen Receptor 1(ESR1) (NM_000125) Human Untagged Clone
Symbol ESR1
Synonyms ER; Era; ESR; ESRA; ESTRR; NR3A1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC125287 sequence for NM_000125 edited (data generated by NextGen Sequencing)
ATGACCATGACCCTCCACACCAAAGCATCTGGGATGGCCCTACTGCATCAGATCCAAGGG
AACGAGCTGGAGCCCCTGAACCGTCCGCAGCTCAAGATCCCCCTGGAGCGGCCCCTGGGC
GAGGTGTACCTGGACAGCAGCAAGCCCGCCGTGTACAACTACCCCGAGGGCGCCGCCTAC
GAGTTCAACGCCGCGGCCGCCGCCAACGCGCAGGTCTACGGTCAGACCGGCCTCCCCTAC
GGCCCCGGGTCTGAGGCTGCGGCGTTCGGCTCCAACGGCCTGGGGGGTTTCCCCCCACTC
AACAGCGTGTCTCCGAGCCCGCTGATGCTACTGCACCCGCCGCCGCAGCTGTCGCCTTTC
CTGCAGCCCCACGGCCAGCAGGTGCCCTACTACCTGGAGAACGAGCCCAGCGGCTACACG
GTGCGCGAGGCCGGCCCGCCGGCATTCTACAGGCCAAATTCAGATAATCGACGCCAGGGT
GGCAGAGAAAGATTGGCCAGTACCAATGACAAGGGAAGTATGGCTATGGAATCTGCCAAG
GAGACTCGCTACTGTGCAGTGTGCAATGACTATGCTTCAGGCTACCATTATGGAGTCTGG
TCCTGTGAGGGCTGCAAGGCCTTCTTCAAGAGAAGTATTCAAGGACATAACGACTATATG
TGTCCAGCCACCAACCAGTGCACCATTGATAAAAACAGGAGGAAGAGCTGCCAGGCCTGC
CGGCTCCGCAAATGCTACGAAGTGGGAATGATGAAAGGTGGGATACGAAAAGACCGAAGA
GGAGGGAGAATGTTGAAACACAAGCGCCAGAGAGATGATGGGGAGGGCAGGGGTGAAGTG
GGGTCTGCTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATCAAACGC
TCTAAGAAGAACAGCCTGGCCTTGTCCCTGACGGCCGACCAGATGGTCAGTGCCTTGTTG
GATGCTGAGCCCCCGATACTCTATTCCGAGTATGATCCTACCAGACCCTTCAGTGAAGCT
TCGATGATGGGCTTACTGACCAACCTGGCAGACAGGGAGCTGGTTCACATGATCAACTGG
GCGAAGAGGGTGCCAGGCTTTGTGGATTTGACCCTCCATGATCAGGTCCACCTTCTAGAA
TGTGCCTGGCTAGAGATCCTGATGATTGGTCTCGTCTGGCGCTCCATGGAGCACCCAGTG
AAGCTACTGTTTGCTCCTAACTTGCTCTTGGACAGGAACCAGGGAAAATGTGTAGAGGGC
ATGGTGGAGATCTTCGACATGCTGCTGGCTACATCATCTCGGTTCCGCATGATGAATCTG
CAGGGAGAGGAGTTTGTGTGCCTCAAATCTATTATTTTGCTTAATTCTGGAGTGTACACA
TTTCTGTCCAGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGAC
AAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAG
CACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAA
GGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTG
CTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTG
GAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCATCGCATTCCTTGCAA
AAGTATTACATCACGGGGGAGGCAGAGGGTTTCCCTGCCACGGTCTGA

Clone variation with respect to NM_000125.3
975 c=>g;1199 g=>t
Tag Tag Free
ACCN NM_000125
ORF Size 1788 bp
Insert Size 3500
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000125.2, NP_000116
RefSeq Size 6456
Locus ID 2099
Cytogenetics 6q25.1-q25.2
Domains HOLI, Oest_recep, zf-C4
Protein Families Nuclear Hormone Receptor, Transcription Factors, Druggable Genome
Gene Summary This gene encodes an estrogen receptor, a ligand-activated transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription. The protein localizes to the nucleus where it may form a homodimer or a heterodimer with estrogen receptor 2. Estrogen and its receptors are essential for sexual development and reproductive function, but also play a role in other tissues such as bone. Estrogen receptors are also involved in pathological processes including breast cancer, endometrial cancer, and osteoporosis. Alternative promoter usage and alternative splicing result in dozens of transcript variants, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (1) uses the most proximal promoter, and encodes isoform 1. Variants 1-4 all encode the same isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations