ABCB5 (NM_178559) Human Untagged Clone

CAT#: SC125267

ABCB5 (untagged)-Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5), transcript variant 2

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ABCB5 (NM_178559) Human Untagged Clone
Symbol ABCB5
Synonyms ABCB5alpha; ABCB5beta; EST422562
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_178559 edited
ATGGTGGATGAGAATGACATCAGAGCTTTAAATGTGCGGCATTATCGAGACCATATTGGA
GTGGTTAGTCAAGAGCCTGTTTTGTTCGGGACCACCATCAGTAACAATATCAAGTATGGA
CGAGATGATGTGACTGATGAAGAGATGGAGAGAGCAGCAAGGGAAGCAAATGCGTATGAT
TTTATCATGGAGTTTCCTAATAAATTTAATACATTGGTAGGGGAAAAAGGAGCTCAAATG
AGTGGAGGGCAGAAACAGAGGATCGCAATTGCTCGTGCCTTAGTTCGAAACCCCAAGATT
CTGATTTTAGATGAGGCTACGTCTGCCCTGGATTCAGAAAGCAAGTCAGCTGTTCAAGCT
GCACTGGAGAAGGCGAGCAAAGGTCGGACTACAATCGTGGTAGCACACCGACTTTCTACT
ATTCGAAGTGCAGATTTGATTGTGACCCTAAAGGATGGAATGCTGGCGGAGAAAGGAGCA
CATGCTGAACTAATGGCAAAACGAGGTCTATATTATTCACTTGTGATGTCACAGGATATT
AAAAAAGCTGATGAACAGATGGAGTCAATGACATATTCTACTGAAAGAAAGACCAACTCA
CTTCCTCTGCACTCTGTGAAGAGCATCAAGTCAGACTTCATTGACAAGGCTGAGGAATCC
ACCCAATCTAAAGAGATAAGTCTTCCTGAAGTCTCTCTATTAAAAATTTTAAAGTTAAAC
AAGCCTGAATGGCCTTTTGTGGTTCTGGGGACATTGGCTTCTGTTCTAAATGGAACTGTT
CATCCAGTATTTTCCATCATCTTTGCAAAAATTATAACCATGTTTGGAAATAATGATAAA
ACCACATTAAAGCATGATGCAGAAATTTATTCCATGATATTCGTCATTTTGGGTGTTATT
TGCTTTGTCAGTTATTTCATGCAGGGATTATTTTACGGCAGAGCAGGGGAAATTTTAACG
ATGAGATTAAGACACTTGGCCTTCAAAGCCATGTTATATCAGGATATTGCCTGGTTTGAT
GAAAAGGAAAACAGCACAGGAGGCTTGACAACAATATTAGCCATAGATATAGCACAAATT
CAAGGAGCAACAGGTTCCAGGATTGGCGTCTTAACACAAAATGCAACTAACATGGGACTT
TCAGTTATCATTTCCTTTATATATGGATGGGAGATGACATTCCTGATTCTGAGTATTGCT
CCAGTACTTGCCGTGACAGGAATGATTGAAACCGCAGCAATGACTGGATTTGCCAACAAA
GATAAGCAAGAACTTAAGCATGCTGGAAAGATAGCAACTGAAGCTTTGGAGAATATACGT
ACTATAGTGTCATTAACAAGGGAAAAAGCCTTCGAGCAAATGTATGAAGAGATGCTTCAG
ACTCAACACAGAAATACCTCGAAGAAAGCACAGATTATTGGAAGCTGTTATGCATTCAGC
CATGCCTTTATATATTTTGCCTATGCGGCAGGGTTTCGATTTGGAGCCTATTTAATTCAA
GCTGGACGAATGACCCCAGAGGGCATGTTCATAGTTTTTACTGCAATTGCATATGGAGCT
ATGGCCATCGGAGAAACGCTCGTTTTGGCTCCTGAATATTCCAAAGCCAAATCGGGGGCT
GCGCATCTGTTTGCCTTGTTGGAAAAGAAACCAAATATAGACAGCCGCAGTCAAGAAGGG
AAAAAGCCAGACACATGTGAAGGGAATTTAGAGTTTCGAGAAGTCTCTTTCTTCTATCCA
TGTCGCCCAGATGTTTTCATCCTCCGTGGCTTATCCCTCAGTATTGAGCGAGGAAAGACA
GTAGCATTTGTGGGGAGCAGCGGCTGTGGGAAAAGCACTTCTGTTCAACTTCTGCAGAGA
CTTTATGACCCCGTGCAAGGACAAGTGCTGTTTGATGGTGTGGATGCAAAAGAATTGAAT
GTACAGTGGCTCCGTTCCCAAATAGCAATCGTTCCTCAAGAGCCTGTGCTCTTCAACTGC
AGCATTGCTGAGAACATCGCCTATGGTGACAACAGCCGTGTGGTGCCATTAGATGAGATC
AAAGAAGCCGCAAATGCAGCAAATATCCATTCTTTTATTGAAGGTCTCCCTGAGAAATAC
AACACACAAGTTGGACTGAAAGGAGCACAGCTTTCTGGCGGCCAGAAACAAAGACTAGCT
ATTGCAAGGGCTCTTCTCCAAAAACCCAAAATTTTATTGTTGGATGAGGCCACTTCAGCC
CTCGATAATGACAGTGAGAAGGTGGTTCAGCATGCCCTTGATAAAGCCAGGACGGGAAGG
ACATGCCTAGTGGTCACTCACAGGCTCTCTGCAATTCAGAACGCAGATTTGATAGTGGTT
CTGCACAATGGAAAGATAAAGGAACAAGGAACTCATCAAGAGCTCCTGAGAAATCGAGAC
ATATATTTTAAGTTAGTGAATGCACAGTCAGTGCAGTGA
Tag Tag Free
ACCN NM_178559
ORF Size 2439 bp
Insert Size 2400
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_178559.3.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_178559.3, NP_848654
RefSeq Size 2906
Locus ID 340273
Cytogenetics 7p21.1
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008].
Transcript Variant: This variant (2) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to variant 1. This variant (2) is the mRNA isoform beta as described in PMID 15760339.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.