HFE (NM_139005) Human Untagged Clone

CAT#: SC124535

HFE (untagged)-ORIGENE UNIQUE VARIANT 1 of Human hemochromatosis (HFE),

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HFE (NM_139005) Human Untagged Clone
Symbol HFE
Synonyms HH, HFE1, HLA-H, MGC103790, dJ221C16.10.1;HFE1; HH; HLA-H; MGC103790; dJ221C16.10.1; MHC class I-like protein HFE; hemochromatosis protein; hereditary hemochromatosis protein HLA-H; hemochromatosis
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_139005, the custom clone sequence may differ by one or more nucleotides


ATGGGCCCGCGAGCCAGGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTGCAGGGGCGCT
TGCTGCGTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCTTGTT
TGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTCGCCGTGTGGAGCCC
CGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATGTGGCTGCAGCTGAGTCAGAGTCTGAAAGGGT
GGGATCACATGTTCACTGTTGACTTCTGGACTATTATGGAAAATCACAACCACAGCAAGGAGTCCCACAC
CCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACCGAGGGCTACTGGAAGTACGGGTAT
GATGGGCAGGACCACCTTGAATTCTGCCCTGACACACTGGATTGGAGAGCAGCAGAACCCAGGGCCTGGC
CCACCAAGCTGGAGTGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTG
CCCTGCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAAGTGCCTCCTTTGGTG
AAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTACGGTGTCGGGCCTTGAACTACTACCCCCAGA
ACATCACCATGAAGTGGCTGAAGGATAAGCAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATT
GCCCAATGGGGATGGGACCTACCAGGGCTGGATAACCTTGGCTGTACCCCCAAAGTGCTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_139005 unedited
GTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCTCGTGCCGAATTCGG
CACGAGGGCCGGGGGAGGGGGCAGGTCCTGGGGCGAGGGACCCCTATCTGCAGTTCAGTG
GTAGGCACTCCCTCACGGGGTCTGGACGCAGAAAGTAGGGAGAGGGGCTTGCGGATAGGG
TTGAGCAGGTCCTCCAAAGTTAGCAAACTCCCAAGCGCAAAGAAAAAGCTAGTTTCGATT
TTTCCACCCCCGCCGCGCCCCTAGTTCGCCCGCAGCCCTCGGACTCACGCAGCAAGCGCC
CCTGCAGGACCGCGGTCTGCAAAAGCATCAGGAGGAGAAGCGCCGGCCTGGCTCGCGGGC
CCATTTCCCCAGCTCTGGCCGCACGTCCCCGTTAAATCTCCGCTTCTTTTGGGGGGCGGG
GAAACGGGGATGGCTCCAGAAGTCACCCTACAGCTATTGCCTAGGCTCAGGAGATGCCCA
GTAAAACTTCCTGGTGAAAAGCAACAGGTCTTTCAGAACTTTAGTTCTCTCTCTCCTACA
GCAGAAGGTACCTGCTTGTGAAACACTAGGTGATCCAGTGTCCCCCTTGGTTTTTAAATC
CTGAAGGGGTGTTGTTGATTGGGGAAAGTAGCTTCGCAATGTTCTGATCTGAACTTTAGA
TATTTAAATATTTATGATTTTCAAAATTCAATCATACATTTAAAAATTTTATCTCAACCT
TAGACCAACTTATGTCTTATTTGACTTAGAAAATAAAGCTTTTTCATTTTGTTTTTTGAT
TCAAATAATTAAGTCATAACATTAACCAATTAGATCCTACTGAAACACTTNCCACAGCCT
TCATAATTGAATATCTGANCAGTGTTTACAAACTTTACAGTATGGGGATATCTGGAGAAG
G
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_139005
ORF Size 831 bp
OTI Disclaimer The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required.
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_139005.1, NP_620574
RefSeq Size 1140
Locus ID 3077
Cytogenetics 6p22.2
Protein Families Transmembrane, Druggable Genome
Gene Summary The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (5) lacks the 3' end of the coding region and includes an alternate exon, compared to variant 1. The protein encoded (isoform 5) has a unique carboxy terminus.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.