MRP1(ABCC1) (NM_019902) Human Untagged Clone

CAT#: SC124215

ABCC1 (untagged)-Human ATP-binding cassette, sub-family C (CFTR/MRP), member 1 (ABCC1), transcript variant 7

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MRP1(ABCC1) (NM_019902) Human Untagged Clone
Symbol ABCC1
Synonyms MRP, ABCC, GS-X, MRP1, ABC29, DKFZp781G125, DKFZp686N04233
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC124215 sequence for NM_019902 edited (data generated by NextGen Sequencing)
ATGGCGCTCCGGGGCTTCTGCAGCGCCGATGGCTCCGACCCGCTCTGGGACTGGAATGTC
ACGTGGAATACCAGCAACCCCGACTTCACCAAGTGCTTTCAGAACACGGTCCTCGTGTGG
GTGCCTTGTTTTTACCTCTGGGCCTGTTTCCCCTTCTACTTCCTCTATCTCTCCCGACAT
GACCGAGGCTACATTCAGATGACACCTCTCAACAAAACCAAAACTGCCTTGGGATTTTTG
CTGTGGATCGTCTGCTGGGCAGACCTCTTCTACTCTTTCTGGGAAAGAAGTCGGGGCATA
TTCCTGGCCCCAGTGTTTCTGGTCAGCCCAACTCTCTTGGGCATCACCATGCTGCTTGCT
ACCTTTTTAATTCAGCTGGAGAGGAGGAAGGGAGTTCAGTCTTCAGGGATCATGCTCACT
TTCTGGCTGGTAGCCCTAGTGTGTGCCCTAGCCATCCTGAGATCCAAAATTATGACAGCC
TTAAAAGAGGATGCCCAGGTGGACCTGTTTCGTGACATCACTTTCTACGTCTACTTTTCC
CTCTTACTCATTCAGCTCGTCTTGTCCTGTTTCTCAGATCGCTCACCCCTGTTCTCGGAA
ACCATCCACGACCCTAATCCCTGCCCAGAGTCCAGCGCTTCCTTCCTGTCGAGGATCACC
TTCTGGTGGATCACAGGGTTGATTGTCCGGGGCTACCGCCAGCCCCTGGAGGGCAGTGAC
CTCTGGTCCTTAAACAAGGAGGACACGTCGGAACAAGTCGTGCCTGTTTTGGTAAAGAAC
TGGAAGAAGGAATGCGCCAAGACTAGGAAGCAGCCGGTGAAGGTCGTGTACTCCTCCAAG
GATCCTGCCCAGCCGAAAGAGAGTTCCAAGGTGGATGCGAATGAGGAGGTGGAGGCTTTG
ATCGTCAAGTCCCCACAGAAGGAGTGGAACCCCTCTCTGTTTAAGGTGTTATACAAGACC
TTTGGGCCCTACTTCCTCATGAGCTTCTTCTTCAAGGCCATCCACGACCTGATGATGTTT
TCCGGGCCGCAGATCTTAAAGTTGCTCATCAAGTTCGTGAACGACACGAAGGCCCCAGAC
TGGCAGGGCTACTTCTACACCGTGCTGCTGTTTGTCACTGCCTGCCTGCAGACCCTCGTG
CTGCACCAGTACTTCCACATCTGCTTCGTCAGTGGCATGAGGATCAAGACCGCTGTCATT
GGGGCTGTCTATCGGAAGGCCCTGGTGATCACCAATTCAGCCAGAAAATCCTCCACGGTC
GGGGAGATTGTCAACCTCATGTCTGTGGACGCTCAGAGGTTCATGGACTTGGCCACGTAC
ATTAACATGATCTGGTCAGCCCCCCTGCAAGTCATCCTTGCTCTCTACCTCCTGTGGCTG
AATCTGGGCCCTTCCGTCCTGGCTGGAGTGGCGGTGATGGTCCTCATGGTGCCCGTCAAT
GCTGTGATGGCGATGAAGACCAAGACGTATCAGGTGGCCCACATGAAGAGCAAAGACAAT
CGGATCAAGCTGATGAACGAAATTCTCAATGGGATCAAAGTGCTAAAGCTTTATGCCTGG
GAGCTGGCATTCAAGGACAAGGTGCTGGCCATCAGGCAGGAGGAGCTGAAGGTGCTGAAG
AAGTCTGCCTACCTGTCAGCCGTGGGCACCTTCACCTGGGTCTGCACGCCCTTTCTGGCG
AGTGTCTCCCTCAAACGCCTGAGGATCTTTCTCTCCCATGAGGAGCTGGAACCTGACAGC
ATCGAGCGACGGCCTGTCAAAGACGGCGGGGGCACGAACAGCATCACCGTGAGGAATGCC
ACATTCACCTGGGCCAGGAGCGACCCTCCCACACTGAATGGCATCACCTTCTCCATCCCC
GAAGGTGCTTTGGTGGCCGTGGTGGGCCAGGTGGGCTGCGGAAAGTCGTCCCTGCTCTCA
GCCCTCTTGGCTGAGATGGACAAAGTGGAGGGGCACGTGGCTATCAAGGGCTCCGTGGCC
TATGTGCCACAGCAGGCCTGGATTCAGAATGATTCTCTCCGAGAAAACATCCTTTTTGGA
TGTCAGCTGGAGGAACCATATTACAGGTCCGTGATACAGGCCTGTGCCCTCCTCCCAGAC
CTGGAAATCCTGCCCAGTGGGGATCGGACAGAGATTGGCGAGAAGGGCGTGAACCTGTCT
GGGGGCCAGAAGCAGCGCGTGAGCCTGGCCCGGGCCGTGTACTCCAACGCTGACATTTAC
CTCTTCGATGATCCCCTCTCAGCAGTGGATGCCCATGTGGGAAAACACATCTTTGAAAAT
GTGATTGGCCCCAAGGGGATGCTGAAGAACAAGACGCGGATCTTGGTCACGCACAGCATG
AGCTACTTGCCGCAGGTGGACGTCATCATCGTCATGAGTGGCGGCAAGATCTCTGAGATG
GGCTCCTACCAGGAGCTGCTGGCTCGAGACGGCGCCTTCGCTGAGTTCCTGCGTACCTAT
GCCAGCACAGAGCAGGAGCAGGATGCAGAGGAGAACGGGGTCACGGGCGTCAGCGGTCCA
GGGAAGGAAGCAAAGCAAATGGAGAATGGCATGCTGGTGACGGACAGTGCAGGGAAGCAA
CTGCAGAGACAGCTCAGCAGCTCCTCCTCCTATAGTGGGGACATCAGCAGGCACCACAAC
AGCACCGCAGAACTGCAGAAAGCTGAGGCCAAGAAGGAGGAGACCTGGAAGCTGATGGAG
GCTGACAAGGCGCAGACAGGGCAGGTCAAGCTTTCCGTGTACTGGGACTACATGAAGGCC
ATCGGACTCTTCATCTCCTTCCTCAGCATCTTCCTTTTCATGTGTAACCATGTGTCCGCG
CTGGCTTCCAACTATTGGCTCAGCCTCTGGACTGATGACCCCATCGTCAACGGGACTCAG
GAGCACACGAAAGTCCGGCTGAGCGTCTATGGAGCCCTGGGCATTTCACAAGGGATCGCC
GTGTTTGGCTACTCCATGGCCGTGTCCATCGGGGGGATCTTGGCTTCCCGCTGTCTGCAC
GTGGACCTGCTGCACAGCATCCTGCGGTCACCCATGAGCTTCTTTGAGCGGACCCCCAGT
GGGAACCTGGTGAACCGCTTCTCCAAGGAGCTGGACACAGTGGACTCCATGATCCCGGAG
GTCATCAAGATGTTCATGGGCTCCCTGTTCAACGTCATTGGTGCCTGCATCGTTATCCTG
CTGGCCACGCCCATCGCCGCCATCATCATCCCGCCCCTTGGCCTCATCTACTTCTTCGTC
CAGAGGTTCTACGTGGCTTCCTCCCGGCAGCTGAAGCGCCTCGAGTCGGTCAGCCGCTCC
CCGGTCTATTCCCATTTCAACGAGACCTTGCTGGGGGTCAGCGTCATTCGAGCCTTCGAG
GAGCAGGAGCGCTTCATCCACCAGAGTGACCTGAAGGTGGACGAGAACCAGAAGGCCTAT
TACCCCAGCATCGTGGCCAACAGGTGGCTGGCCGTGCGGCTGGAGTGTGTGGGCAACTGC
ATCGTTCTGTTTGCTGCCCTGTTTGCGGTGATCTCCAGGCACAGCCTCAGTGCTGGCTTG
GTGGGCCTCTCAGTGTCTTACTCATTGCAGGTCACCACGTACTTGAACTGGCTGGTTCGG
ATGTCATCTGAAATGGAAACCAACATCGTGGCCGTGGAGAGGCTCAAGGAGTATTCAGAG
ACTGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAG
GTGGGCCGAGTGGAATTCCGGAACTACTGCCTGCGCTACCGAGAGGACCTGGACTTCGTT
CTCAGGCACATCAATGTCACGATCAATGGGGGAGAAAAGGTCGGCATCGTGGGGCGGACG
GGAGCTGGGAAGTCGTCCCTGACCCTGGGCTTATTTCGGATCAACGAGTCTGCCGAAGGA
GAGATCATCATCGATGGCATCAACATCGCCAAGATCGGCCTGCACGACCTCCGCTTCAAG
ATCACCATCATCCCCCAGGACCCTGTTTTGTTTTCGGGTTCCCTCCGAATGAACCTGGAC
CCATTCAGCCAGTACTCGGATGAAGAAGTCTGGACGTCCCTGGAGCTGGCCCACCTGAAG
GACTTCGTGTCAGCCCTTCCTGACAAGCTAGACCATGAATGTGCAGAAGGCGGGGAGAAC
CTCAGTGTCGGGCAGCGCCAGCTTGTGTGCCTAGCCCGGGCCCTGCTGAGGAAGACGAAG
ATCCTTGTGTTGGATGAGGCCACGGCAGCCGTGGACCTGGAAACGGACGACCTCATCCAG
TCCACCATCCGGACACAGTTCGAGGACTGCACCGTCCTCACCATCGCCCACCGGCTCAAC
ACCATCATGGACTACACAAGGGTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGC
GCCCCATCGGACCTCCTGCAGCAGAGAGGTCTTTTCTACAGCATGGCCAAAGACGCCGGC
TTGGTGTGA

Clone variation with respect to NM_019902.1
350 c=>t;825 t=>c;1062 t=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_019902 unedited
ACCCCCGCCCCGTTGNCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCA
GAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGA
ATTCGGCACGAGGCCGGCATGGCGCTCCGGGGCTTCTGCAGCGCCGATGGCTCCGACCCG
CTCTGGGACTGGAATGTCACGTGGAATACCAGCAACCCCGACTTCACCAAGTGCTTTCAG
AACACGGTCCTCGTGTGGGTGCCTTGTTTTTACCTCTGGGCCTGTTTCCCCTTCTACTTC
CTCTATCTCTCCCGACATGACCGAGGCTACATTCAGATGACACCTCTCAACAAAACCAAA
ACTGCCTTGGGATTTTTGCTGTGGATCGTCTGCTGGGCAGACCTCTTCTACTCTTTCTGG
GAAAGAAGTCGGGGCATATTCCTGGCCCCAGTGNTTCTGGTCAGCCCAACTCTCTTGGGC
ATCACCATGCTGCTTGCTACCTTTTTAATTCCCCGGAGATCACCACCCCTTCCACTCTCC
CCCTTTCCCTTCCTCCCCTCCTCCCGCNNNNNNNNNNCNNNCNNCNNCCCNNNNNNTCNN
NNCCCNCCNNNCCCNCCCCCCCCCCCCNCCCCNCCCCCNCCTCCCCCCCCCCCCCCCCNN
NCCNCCCCCCCCCCCCCCCCCCCCCCCNCCCCCCCCCCTCCCCCCNCNCCCCCCCCCCGC
CCCCCCNCCCNCCCCCCCCCCNCNNCCCNTNCCCCCCNCTCNNCCCCCCCCCCNNCCCCC
CCTCNCNCCCCACCCCCCCCCCNCCCCCCCCCCCCCCCCCCNCNCCNCCNNCCCCNCNCC
CCCCNNNCCCCCCCCCCCNNCCCNNNCCCCCCCCCCCCCCCCCCCCNNCCCCCCCCCCCC
CCCCCCCNCTTCTTTTCCTCCCCTTCTCTCCCTTCTTCCCCCCN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_019902
ORF Size 4449 bp
Insert Size 6000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_019902.1, NP_063957
RefSeq Size 5780
RefSeq ORF 4449
Locus ID 4363
Cytogenetics 16p13.11
Domains ABC_membrane, ABC_tran, AAA
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra-and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a multispecific organic anion transporter, with oxidized glutatione, cysteinyl leukotrienes, and activated aflatoxin B1 as substrates. This protein also transports glucuronides and sulfate conjugates of steroid hormones and bile salts. Alternatively spliced variants of this gene have been described but their full-length nature is unknown. [provided by RefSeq, Apr 2012].
Transcript Variant: This variant (7) lacks exon 13, as compared to the predominant, full-length transcript variant 1. This results in a 49-amino acid in-frame deletion in the coding region.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.