Myostatin Propeptide(MSTN) (NM_005259) Human Untagged Clone

CAT#: SC124056

MSTN (untagged)-Human myostatin (MSTN)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Myostatin Propeptide(MSTN) (NM_005259) Human Untagged Clone
Symbol MSTN
Synonyms GDF8; MSLHP
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC124056 sequence for NM_005259 edited (data generated by NextGen Sequencing)
ATGCAAAAACTGCAACTCTGTGTTTATATTTACCTGTTTATGCTGATTGTTGCTGGTCCA
GTGGATCTAAATGAGAACAGTGAGCAAAAAGAAAATGTGGAAAAAGAGGGGCTGTGTAAT
GCATGTACTTGGAGACAAAACACTAAATCTTCAAGAATAGAAGCCATTAAGATACAAATC
CTCAGTAAACTTCGTCTGGAAACAGCTCCTAACATCAGCAAAGATGTTATAAGACAACTT
TTACCCAAAGCTCCTCCACTCCGGGAACTGATTGATCAGTATGATGTCCAGAGGGATGAC
AGCAGCGATGGCTCTTTGGAAGATGACGATTATCACGCTACAACGGAAACAATCATTACC
ATGCCTACAGAGTCTGATTTTCTAATGCAAGTGGATGGAAAACCCAAATGTTGCTTCTTT
AAATTTAGCTCTAAAATACAATACAATAAAGTAGTAAAGGCCCAACTATGGATATATTTG
AGACCCGTCGAGACTCCTACAACAGTGTTTGTGCAAATCCTGAGACTCATCAAACCTATG
AAAGACGGTACAAGGTATACTGGAATCCGATCTCTGAAACTTGACATGAACCCAGGCACT
GGTATTTGGCAGAGCATTGATGTGAAGACAGTGTTGCAAAATTGGCTCAAACAACCTGAA
TCCAACTTAGGCATTGAAATAAAAGCTTTAGATGAGAATGGTCATGATCTTGCTGTAACC
TTCCCAGGACCAGGAGAAGATGGGCTGAATCCGTTTTTAGAGGTCAAGGTAACAGACACA
CCAAAAAGATCCAGAAGGGATTTTGGTCTTGACTGTGATGAGCACTCAACAGAATCACGA
TGCTGTCGTTACCCTCTAACTGTGGATTTTGAAGCTTTTGGATGGGATTGGATTATCGCT
CCTAAAAGATATAAGGCCAATTACTGCTCTGGAGAGTGTGAATTTGTATTTTTACAAAAA
TATCCTCATACTCATCTGGTACACCAAGCAAACCCCAGAGGTTCAGCAGGCCCTTGCTGT
ACTCCCACAAAGATGTCTCCAATTAATATGCTATATTTTAATGGCAAAGAACAAATAATA
TATGGGAAAATTCCAGCGATGGTAGTAGACCGCTGTGGGTGCTCATGA

Clone variation with respect to NM_005259.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005259 unedited
GGGCGGCCGCAAATTCGGCACGAGATTCACTGGTGTGGCAAGTTGTCTCTCAGACTGTAC
ATGCATTAAAATTTTGCTTGGCATTACTCAAAAGCAAAAGAAAAGTAAAAGGAAGAAACA
AGAACAAGAAAAAAGATTATATTGATTTTAAAATCATGCAAAAACTGCAACTCTGTGTTT
ATATTTACCTGTTTATGCTGATTGTTGCTGGTCCAGTGGATCTAAATGAGAACAGTGAGC
AAAAAGAAAATGTGGAAAAAGAGGGGCTGTGTAATGCATGTACTTGGAGACAAAACACTA
AATCTTCAAGAATAGAAGCCATTAAGATACAAATCCTCAGTAAACTTCGTCTGGAAACAG
CTCCTAACATCAGCAAAGATGTTATAAGACAACTTTTACCCAAAGCTCCTCCACTCCGGG
AACTGATTGATCAGTATGATGTCCAGAGGGATGACAGCAGCGATGGCTCTTTGGAAGATG
ACGATTATCACGCTACAACGGAAACCATCATTACCATGGCTTCCGAAGTCTGATTTTCTA
ATGCAAGTGGATGGAAAACCCAAATGTTGCTTCTNTTAAATTTAGCTCTANATACAATAC
AATAAAGTAGTAAGGCCCAACTATGGATATATTTGAGAACCGTCGAGACTCCTACAACAG
TGTTTGTGCANATCCTGAGACTCATCANACCTATGAAAGACGGTACAGGTATACTGGAAT
CGAATCTTGAACTTGAATGAACCAGGCACTGTATTTGCAGACC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005259 unedited
AGGCACTGGNAAGGGGTCACAGGGATGCCACCCGGGATCTGTTCAGGAAACAGCTATGAC
CGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGAGATAGCATCAGTTTATT
CTTCATTTCAGATAATAGAGTCAATTATTTTGGTATACTTAGTAATGTTTTTGCAAGTAT
TAAAATAATGGAACGTTGAGATTTAAACACAATGACAGTAAACCATTGAAATTTCAAATT
CACTTTATACAGCCATCATGAATCCATAAGTGAATGTTAATCATGTAAAAAAATATAAAA
TGATTGTAATATAACCATCTAATCATTAACATATGGAGTTTTAAGACCACTATTTAATCT
GCTAATTTGCTCTGAAATATAAGTAGTTGCTTTTCTGTGATGCATGACATGTCTTTGTGC
CTTAGTACTTAATTTGAAATGTCCTTAGTGTAAAAATATACCAAAGTAAATAAAAAAGGA
GACACTTATTTACAAAACAATATTGTATACATATTATATAAATGCATTGTTTCATTCTTT
TATACAATATTGATAGAGTCGATCATTTCTATTATTTTACCATAAAAACTGCAGTGTTGC
AAAAGCAGTGTTGTAATTTTCANAGACAAAATACATACTCTCCAGTATGTATTTTGCATT
TTGATAANACAACACCATTGACTGCCTTTAGAAAATGCATTCTTCAATTTGTTACGAATG
AAGCCACCTTTGAAAATGATCTCTTCATAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005259
ORF Size 1128 bp
Insert Size 2700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005259.1, NP_005250
RefSeq Size 2823
Locus ID 2660
Cytogenetics 2q32.2
Protein Families Secreted Protein, Druggable Genome
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein negatively regulates skeletal muscle cell proliferation and differentiation. Mutations in this gene are associated with increased skeletal muscle mass in humans and other mammals. [provided by RefSeq, Jul 2016].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.