Kv beta 1 (KCNAB1) (NM_003471) Human Untagged Clone

CAT#: SC123984

Reviews ()
Write a review

KCNAB1 (untagged)-Human potassium voltage-gated channel, shaker-related subfamily, beta member 1 (KCNAB1), transcript variant 2



  "NM_003471" in other vectors (4)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 690.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Kv beta 1 (KCNAB1) (NM_003471) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol KCNAB1
Synonyms AKR6A3; hKvb3; hKvBeta3; KCNA1B; KV-BETA-1; Kvb1.3
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_003471 edited
ATGCATCTGTATAAACCTGCCTGTGCAGACATCCCGAGCCCCAAGCTGGGTCTGCCAAAA
TCCAGTGAATCGGCTCTAAAATGTAGATGGCACCTAGCAGTGACCAAGACTCAGCCTCAG
GCGGCCTGCAAACCTGTGAGGCCCAGTGGAGCAGCCGAACAGAAATATGTGGAAAAGTTT
CTACGTGTTCATGGAATTTCGTTGCAGGAAACCACCAGAGCAGAGACGGGCATGGCATAC
AGGAATCTTGGAAAATCAGGACTCAGAGTTTCTTGCTTGGGTCTTGGAACATGGGTGACA
TTTGGAGGTCAAATTTCAGATGAGGTTGCTGAACGGCTGATGACCATCGCCTATGAAAGT
GGTGTTAACCTCTTTGATACTGCCGAAGTCTATGCTGCTGGAAAGGCTGAAGTGATTCTG
GGGAGCATCATCAAGAAGAAAGGCTGGAGGAGGTCCAGTCTGGTCATAACAACCAAACTC
TACTGGGGTGGAAAAGCTGAAACAGAAAGAGGGCTGTCAAGAAAGCATATTATTGAAGGA
TTGAAGGGCTCCCTCCAGAGGCTGCAGCTCGAGTATGTGGATGTGGTCTTTGCAAATCGA
CCGGACAGTAACACTCCCATGGAAGAAATTGTCCGAGCCATGACACATGTGATAAACCAA
GGCATGGCGATGTACTGGGGCACCTCGAGATGGAGTGCTATGGAGATCATGGAAGCCTAT
TCTGTAGCAAGACAGTTCAATATGATCCCACCGGTCTGTGAACAAGCTGAGTACCATCTT
TTCCAGAGAGAGAAAGTGGAGGTCCAGCTGCCAGAGCTCTACCACAAAATAGGTGTTGGC
GCAATGACATGGTCTCCACTTGCCTGTGGAATCATCTCAGGAAAATACGGAAACGGGGTG
CCTGAAAGTTCCAGGGCTTCACTGAAGTGCTACCAGTGGTTGAAAGAAAGAATTGTAAGT
GAAGAAGGGAGAAAACAGCAAAACAAGCTAAAAGACCTTTCCCCAATTGCGGAGCGTCTG
GGATGCACACTACCTCAGCTAGCTGTTGCGTGGTGCCTGAGAAATGAAGGTGTGAGTTCT
GTGCTCCTGGGATCATCCACTCCTGAACAACTCATTGAAAACCTTGGTGCCATTCAGGTT
CTCCCAAAGATGACATCACATGTGGTAAATGAGATTGATAACATACTGCGCAACAAGCCC
TACAGCAAGAAGGACTATAGATCATAA
>OriGene 5' read for NM_003471 unedited
AGTTCGAATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACCAGCGGGAACTTA
GGAGCCTGCTCGCCTAAAAATGATAAGAGAGATCTAAAGAAAACAAGCTAAACCTTTTGA
GGGACATACTGAAGCCAGATAACCCAAGGTATTCACAGCAAGATACAGTGAGTCTTAAAG
TTAAGCACCGTGCAATTAGCTTTGCTTCCTTGGGTTTTTGAAACATGCATCTGTATAAAC
CTGCCTGTGCAGACATCCCGAGCCCCAAGCTGGGTCTGCCAAAATCCAGTGAATCGGCTC
TAAAATGTAGATGGCACCTAGCAGTGACCAAGACTCAGCCTCAGGCGGCCTGCAAACCTG
TGAGGCCCAGTGGAGCAGCCGAACAGAAATATGTGGAAAAGTTTCTACGTGTTCATGGAA
TTTCGTTGCAGGAAACCACCAGAGCAGAGACGGGCATGGCATACAGGAATCTTGGAAAAT
CANGACTCAGAGTTTCTTGCTTGGGTCTTGGAACATGGGTGACATTTGGAGGTCAAATTT
CAGATGANGTTGCTGAACGGCTGATGACCATCGCCTATGAAAGTGGTGTTAACCTCTTTG
ATACTGCCGAAATCTATGCTGCTGGGAAGGCTGAAGTGATTCTGGGGAGCATCATCAAGA
AGAAAGGGCTGGAGGAGTCCAGTCTGGTCATAACACCCAAACTCTACTGGGGTGGAAAAG
CTNGAACAGAAAGAGGGCTGTCAAGAAAGCATATTATTGAAAGGATGAAGGGCTCCCTCC
AAAGCTGCANNCTCAGTATGTGGATGTGGTCTTTGCAAATCGACCGCCAGTAACCCTCCC
ATGGAAGAAATTTTCCAACCATGAACATGTGGATAAACAAGCCATGGCGATGTCTTGGGG
CACCCCGGAAGGATGCTTGGG
Restriction Sites NotI-NotI     
ACCN NM_003471
Insert Size 4000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003471.2, NP_003462.2
RefSeq Size 3301 bp
RefSeq ORF 1227 bp
Locus ID 7881
Cytogenetics 3q25.31
Domains aldo_ket_red
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (2) has an alternate 5' sequence including the 5' UTR and the 5' coding region, as compared to variant 1. It encodes isoform 2, also known as kvb1.2, which has a shorter and distinct N-terminus than isoform 1.

Other Versions

Other products for "KCNAB1"
Frequently bought together (2)
KCNAB1 (Kv beta 1) mouse monoclonal antibody, clone OTI7F12 (formerly 7F12)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools