Follistatin(FST) (BC004107) Human Untagged Clone

CAT#: SC123768

FST (untagged)-Human follistatin, transcript variant FST344 (cDNA clone MGC:10663 IMAGE:3688745), complete cds

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Follistatin(FST) (BC004107) Human Untagged Clone
Symbol FST
Synonyms FS; follistatin isoform FST317; follistatin
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for BC004107 edited
CCCCCGTCTAGATTTAAAGCGCGGCTGCGCCCGGCTTCTGACGTCCATTGAATCGCGCGG
GCGGCCGGCGGCGAGCGCGGGGCTGCGCCGGGATCGCTGCGCCCTCCGCCGCTGGCCTCT
GCGACGCGCGCCGCTCGCCCGAGCCACCCGCCGCCGCGCCGGCTCCCCGCGCCGCTGCGC
TCCTCGCCCCGCGCCTGCCCCCAGGATGGTCCGCGCGAGGCACCAGCCGGGTGGGCTTTG
CCTCCTGCTGCTGCTGCTCTGCCAGTTCATGGAGGACCGCAGTGCCCAGGCTGGGAACTG
CTGGCTCCGTCAAGCGAAGAACGGCCGCTGCCAGGTCCTGTACAAGACCGAACTGAGCAA
GGAGGAGTGCTGCAGCACCGGCCGGCTGAGCACCTCGTGGACCGAGGAGGACGTGAATGA
CAACACACTCTTCAAGTGGATGATTTTCAACGGGGGCGCCCCCAACTGCATCCCCTGTAA
AGAAACGTGTGAGAACGTGGACTGTGGACCTGGGAAAAAATGCCGAATGAACAAGAAGAA
CAAACCCCGCTGCGTCTGCGCCCCGGATTGTTCCAACATCACCTGGAAGGGTCCAGTCTG
CGGGCTGGATGGGAAAACCTACCGCAATGAATGTGCACTCCTAAAGGCAAGATGTAAAGA
GCAGCCAGAACTGGAAGTCCAGTACCAAGGCAGATGTAAAAAGACTTGTCGGGATGTTTT
CTGTCCAGGCAGCTCCACATGTGTGGTGGACCAGACCAATAATGCCTACTGTGTGACCTG
TAATCGGATTTGCCCAGAGCCTGCTTCCTCTGAGCAATATCTCTGTGGGAATGATGGAGT
CACCTACTCCAGTGCCTGCCACCTGAGAAAGGCTACCTGCCTGCTGGGCAGATCTATTGG
ATTAGCCTATGAGGGAAAGTGTATCAAAGCAAAGTCCTGTGAAGATATCCAGTGCACTGG
TGGGAAAAAATGTTTATGGGATTTCAAGGTTGGGAGAGGCCGGTGTTCCCTCTGTGATGA
GCTGTGCCCTGACAGTAAGTCGGATGAGCCTGTCTGTGCCAGTGACAATGCCACTTATGC
CAGCGAGTGTGCCATGAAGGAAGCTGCCTGCTCCTCAGGTGTGCTACTGGAAGTAAAGCA
CTCCGGATCTTGCAACTCCATTTCGGAAGACACCGAGGAAGAGGAGGAAGATGAAGACCA
GGACTACAGCTTTCCTATATCTTCTATTCTAGAGTGGTAAACTCTCTATAAGTGTTCAGT
GTTGACATAGCCTTTGTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAA
AAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for BC004107 unedited
CCGGGTAACCNGTTGGTNTAGTAAACCGNACTCACTGTNAGGNCGTGCCGCGNAATTCGG
CACGAGGCCCCCGTCTTGATTTAAAGCGCGGCTGCGCCCGGCTTCTGACGTCCATTGAAT
CGCGCGGGCGGACGGCGGCGAGCGCGGGGCTGCGCCGGGATCGCTGCGCCCTCCGCCGCT
GGCCTCTGCGACGCGCGCCGCTCGCCCGAGCCACCCGCCGCCGTGCCGGCTCCCCGCGCC
GCTGCGCTCCTCGCCCCGCGCCTGCCCCCAGGATGGTCCGCGCGAGGCACCAGCCGGGTG
GGCTTTGCCTCCTGCTGCTGCTGCTCTGCCAGTTCATGGAGGACCGCAGTGCCCAGGCTG
GGAACTGCTGGCTCCGTCAAGCGAAGAACGGCCGCTGCCAGGTCCTGTACAAGACCGAAC
TGAGCAAGGAGGAGTGCTGCAGCACCGGCCGGCTGAGCACCTCGTGGACCGAGGAGGACG
TGAATGACAACACACTCTTCAAGTGGATGATTTTCAACGGGGGCGCCCCCAACTGCATCC
CCTGTAAAGAAACGTGTGAGAACGTGGACTGTGGACCTGGGAAAAAATGCCGAATGAACA
AGAAGAACAAACCCCGCTGCGTCTGCGCCCCGGATTGTTCCAACATCACCTGGAAGGGTC
CAGTCTGCGGGCTGGATGGGAAAACCTACCGCAATGAATGTGCACTCCTAAAGGCGAGAT
GTAAAGAGCAGCCAGGACTGGAAGTCCAGTACCATAGCAGATGTAAAAAGACTTGTCGGG
ATGTTTTCTGTCCAGGCAGCTCCACATGTGTGGTGGACCAGACCAATAATGCCTACTGTG
TGACCCTGTATCGGATGTGCCCAGAGCCTGCTTGCTCTGAGCATATCTCTGTGGGATGAT
GCAGTCACTACTGCAGTGCCTGCCACCTGGN
3' Read Nucleotide Sequence
>OriGene 3' read for BC004107 unedited
TCCCCCAAATTACTGTGNACCGCGGCCGCTATACTANGATCGNGTTTTTTTTTTTTTTTT
TTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTGCACAAGGCTATGTCAACACTGGAACACT
TATAGAGAGTTTACCACTCTTAGAATAGAAGAATAGGGAAAGCTGTAGTCCTGGTCTTCA
TCTTCCTCCTCTTCCTCGGGGTCTTCCGAAATGGAGTTGCAAGATCCGGAGTGCTTTACT
TCCAGTAGCACACCTGAGGAGCAGGCAGCTTCCTTCATGGGACACTCGCTGGCATAAGTG
GCATTGTCACTGGCACAAACAGGCTCATCCGACTTACTGTCAGGGCACAGCTCATCACAG
AGGGAACACCGGCCTCTCCCAACCTTGAAATCCCATAAACATTTTTTCCCACCAGTGCAC
TGGATATCTTCACAGGACTTTGCTTTGATACACTTTCCCTCATAGGCTAATCCAATAGAT
CTGCCCAGCAGGCAGGTAGCCTTTCTCAGGTGGCAGGCACTGGAGTAGGTGACTCCATCA
TTCCCACAGAGATATTGCTCAAAGGAAGCAGGCTCTGGGCAAATCCGATTACAGGTCACA
CAGTAGGCATTATTGGTCTGGTCCACCACACATGTGGAGCTGCCTGGACAGAAAAATCCC
GACAAGTCTTTTTACATCTGCCTTGGTACTGGACTTCCAGTTTTGGCTGCTCTTTACATC
TTGCCTTTTAGAGTGCACATTCATTGCGGGAGGTTTTCCCATCCAGCCCGCAAACTGGAC
CCTTCCAGTGATGTTGGGACAATCCGGGGCGCACACCCAACGGAGGTTGGTCCTCTTGGT
CAATCCGGCATTTTTCCCAGTGCACAATC
Tag Tag Free
ACCN BC004107
Insert Size 1335
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC004107.2, AAH04107
RefSeq Size 1326
Locus ID 10468
Cytogenetics 5q11.2
Protein Families Secreted Protein, Druggable Genome
Protein Pathways TGF-beta signaling pathway
Gene Summary Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two isoforms, FST317 and FST344 containing 317 and 344 amino acids respectively, resulting from alternative splicing of the precursor mRNA. In a study in which 37 candidate genes were tested for linkage and association with polycystic ovary syndrome (PCOS) or hyperandrogenemia in 150 families, evidence was found for linkage between PCOS and follistatin. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations