NSE2 (NSMCE2) (NM_173685) Human Untagged Clone

CAT#: SC123332

NSMCE2 (untagged)-Human non-SMC element 2, MMS21 homolog (S. cerevisiae) (NSMCE2)


  "NM_173685" in other vectors (6)

Reconstitution Protocol

USD 300.00

5 Days*

Size
    • 10 ug

Product Images

Frequently bought together (4)
NSMCE2 (NSE2) mouse monoclonal antibody, clone OTI4A2 (formerly 4A2)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "NSMCE2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NSMCE2
Synonyms C8orf36; MMS21; NSE2; ZMIZ7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_173685 edited
CCACGCGTCCGGCCCGCTCTCACTTTTCAGCGGCAGGCGAAGGGGGCTGAGGAAAGGAGG
TGGGTCTAGGCAGGGGAAATTGGGGTGCCACCAGACGGAGACAGCTTGGACTACCAGAAT
CAAGCACTCTTTTGGAAGAGGGTAATCTCTCTCCAAAAACTGAGGACACTTACCTTCCCC
ATATATTGAGTCCAGCTGTGTTTGGTGGCCCAGGTACTAATTTCAAGATGCCAGGACGTT
CCAGTTCAAATTCAGGTTCAACTGGTTTCATCTCCTTCAGTGGTGTAGAGTCTGCTCTCT
CCTCCTTGAAAAACTTCCAAGCCTGTATCAACTCTGGTATGGACACAGCTTCTAGTGTTG
CTTTGGATCTTGTGGAAAGTCAGACTGAAGTGAGTAGTGAATATAGTATGGACAAGGCAA
TGGTTGAATTTGCTACATTGGATCGGCAACTAAACCATTATGTAAAGGCTGTTCAATCTA
CAATAAATCATGTGAAAGAAGAACGTCCAGAAAAAATACCAGATTTAAAATTATTGGTAG
AGAAGAAATTTTTGGCTTTACAGAGCAAGAATTCTGATGCAGACTTTCAAAATAATGAAA
AATTTGTACAGTTTAAACAACAGCTGAAAGAACTAAAGAAGCAATGTGGTCTTCAAGCTG
ACAGAGAAGCTGACGGAACAGAAGGAGTGGATGAAGATATAATTGTGACCCAAAGTCAGA
CCAACTTCACCTGCCCCATTACAAAGGAGGAAATGAAGAAGCCAGTGAAAAATAAAGTGT
GTGGCCACACCTATGAAGAGGACGCCATTGTTCGCATGATTGAGTCCAGGCAAAAGCGGA
AGAAAAAGGCCTATTGCCCTCAAATTGGCTGTAGCCACACGGATATAAGAAAGTCAGATC
TTATCCAGGATGAAGCACTTAGAAGGGCAATTGAGAACCATAACAAGAAAAGACATCGTC
ATTCCGAGTAGGAAAAGCCACCTGCCTGCAGGGACACCAGCAGCCTACCTCCTACCCCAG
CTGTCTGTTGAGAGCAGTGCTGACCCCAGCAGTTAGGGACTGGCTGCATAGCATACTTGT
TGGGGGTAAAACTTGTTGCTTTTATGTGTGCTTGAAAACATTTTTCAAAGTTACACAACA
GAAATGCAATCATATTGTTTATTTTTAAGTGTTCTATAATGTTAAATAAAACTTTGATCA
TCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_173685
Insert Size 1258 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_173685.1, NP_775956.1
RefSeq Size 1258 bp
RefSeq ORF 744 bp
Locus ID 286053
UniProt ID Q96MF7
Cytogenetics 8q24.13
Gene Summary This gene encodes a member of a family of E3 small ubiquitin-related modifier (SUMO) ligases that mediates the attachment of a SUMO protein to proteins involved in nuclear transport, transcription, chromosome segregation and DNA repair. The encoded protein is part of the structural maintenance of chromosomes (SMC) 5/6 complex which plays a key role genome maintenance, facilitating chromosome segregation and suppressing mitotic recombination. A knockout of the orthologous mouse gene is lethal prior to embryonic day 10.5. Naturally occurring mutations in this gene, that abolish the SUMO ligase activity, are associated with primordial dwarfism and extreme insulin resistance. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (1) encodes the longer isoform (1). Variants 1-3 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.