CALML3 (NM_005185) Human Untagged Clone

USD 420.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name CALML3 (NM_005185) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol CALML3
Synonyms CLP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_005185 edited
CGGATCTCCACCTGCCACCCCAGAGCTGGGACAGCAGCCGGGCTGCGGCACTGGGAGGGA
GACCCCACAGTGGCCTCTTCTGCCACCCACGCCCCCACCCCTGGCATGGCCGACCAGCTG
ACTGAGGAGCAGGTCACAGAATTCAAGGAGGCCTTCTCCCTGTTTGACAAGGATGGGGAC
GGCTGCATCACCACCCGCGAGCTGGGCACGGTCATGCGGTCCCTGGGCCAGAACCCCACG
GAGGCCGAGCTGCGGGACATGATGAGTGAGATCGACCGGGACGGCAACGGCACCGTGGAC
TTCCCCGAGTTCCTGGGCATGATGGCCAGGAAGATGAAGGACACGGACAACGAGGAGGAG
ATCCGCGAGGCCTTCCGCGTGTTCGACAAGGACGGCAACGGCTTCGTCAGCGCCGCCGAG
CTGCGACACGTCATGACCCGGCTGGGGGAGAAGCTGAGTGACGAGGAGGTGGACGAGATG
ATCCGGGCCGCGGACACGGACGGAGACGGACAGGTGAACTACGAGGAGTTTGTCCGTGTG
CTGGTGTCCAAGTGAGGCCGGCGCCCACCATGCTCCTGGGCGCCCACGCGGCCCACAGGG
CAAGAACCCGGGGCCTCCCGCCTCCTCCCCCATCCCCCTGCCTCCCCTGGGCACTGTGGC
TTCCTCCTGCGCCTGGTTGATTCAGCCCACCTCTCTGCATCCCGCTTCCCGCGTCTCTTC
TCTGCACTCCTGCCGACCTTCCCACCTGCTCATCTGAATGACACGGAACGCTCCCACTGC
AGGCAAACCGTGACGCCCTCCCCACTCGGGAGAAGCAGAGCTGACCTTAGGACCGAGCAC
CAGGGCAGGTTGCGCTGACTCTGCGGCCCTCCAGGACGGACACCGGGTGACCCCTTAGGG
CACCCAGGCAAGATCCCTAAGAGGCACCCAATGCCCAGGCCAGGGGGGCTGCAGCCCTCA
GCCCCCGCCAGGATTCCCGCAGGCTCCTGGACTGGAAGCTCCCTCCGCGGTCGGATTCTG
GAGGGTGGGAGGCATCTTGGCCTGCAGTAAGCGGTGCTGACGGGGACTCTGGCCACAGAG
GTCAGGCCTCCTGAAAACAGCACTGCCTTCCGCGCTGCCCCAGCTTGCCCCATTCCTTGT
CCGCCAACCCACCGTGATTCATCTTCTGAAGCTGGGAGTGAAACTGGGTCAGCTGTAACC
TGTTCCTATTCATCTGGAAGGAGGGAGGCTTGGATGAGCAGGGGATGAGAGCTGCAGGGA
AATAAATGAGATATTCGTCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>OriGene 5' read for NM_005185 unedited
NAAGTTCATATATTTGTATACGACTCACTATAGGCGGCCGCGATTCATATCTGGTACCGG
TCCGGAATTCCCGGGATCGGATCTCCACCTGCCACCCCAGATCTGGGACAGCAGCCGGGC
TGCGGCACTGGGAGGGAGACCCCACAGTGGCCTCTTCTGCCACCCACGCCCCCACCCCTG
GCATGGCCGACCAGCTGACTGAGGAGCAGGTCACAGAATTCAAGGAGGCCTTCTCCCTGT
TTGACAAGGATGGGGACGGCTGCATCACCACCCGCGAGCTGGGCACGGTCATGCGGTCCC
TGGGCCAGAACCCCACGGAGGCCGAGCTGCGGGACATGATGAGTGAGATCGACCGGGACG
GCAACGGCACCGTGGACTTCCCCGAGTTCCTGGGCATGATGGCCAGGAAGATGAAGGACA
CGGACAACGAGGAGGAGATCCGCGAGGCCTTCCGCGTGTTCGACAAGGACGGCAACGGCT
TCGTCAGCGCCGCCGAGCTGCGACACGTCATGACCCGGCTGGGGGAGAAGCTGAGTGACG
AGGAGGTGGACGAGATGATCCGGGCCGCGGACACGGACGGAGACGGACAGGTGAACTACG
AGGAGTTTGTCCGTGTGCTGGTGTCCAAGTGAGGCCGGCGCCCACCATGCTCCTGGGCGC
CCACGCGGCCCACATGGCAAGAACCCCGGGCCTCCCGCCTCCTCCCCCATTCCCCTGCCT
CCCCTGGGCACTGTGGCTTCCTCCTGCGCCTGGTTGATTCAGCCCACCTCTCTGCATCCC
GCTCCCCGCGTCTCTTCTCTGCACTCCTGGCCACTTNCCACCTGGTCATCTGAATGACAA
CGGACGCTCCCACCTGCAGCAACCCGTGACCCCCTCCCACTCGGGAAAAGCAAAACCTGA
CCTAGGACCGATCCCCAGGGCAGGTTGCGCTGG
Restriction Sites Please inquire     
ACCN NM_005185
Insert Size 1316 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005185.1, NP_005176.1
RefSeq Size 450 bp
RefSeq ORF 450 bp
Locus ID 810
Cytogenetics 10p15.1
Protein Pathways Alzheimer's disease, Calcium signaling pathway, Glioma, GnRH signaling pathway, Insulin signaling pathway, Long-term potentiation, Melanogenesis, Neurotrophin signaling pathway, Olfactory transduction, Oocyte meiosis, Phosphatidylinositol signaling system, Vascular smooth muscle contraction

Other Versions

Other products for "CALML3"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools