IL1 beta(IL1B) (NM_000576) Human Untagged Clone

CAT#: SC122566

IL1B (untagged)-Human interleukin 1, beta (IL1B)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name IL1 beta(IL1B) (NM_000576) Human Untagged Clone
Symbol IL1B
Synonyms IL-1; IL1-BETA; IL1F2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000576 edited
GAATTCCCGGGATATCGTCGACCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGACCAAACCTCTTC
GAGGCACAAGGCACAACAGGCTGCTCTGGGATTCTCTTCAGCCAATCTTCATTGCTCAAGTGTCTGAAGC
AGCCATGGCAGAAGTACCTGAGCTCGCCAGTGAAATGATGGCTTATTACAGTGGCAATGAGGATGACTTG
TTCTTTGAAGCTGATGGCCCTAAACAGATGAAGTGCTCCTTCCAGGACCTGGACCTCTGCCCTCTGGATG
GCGGCATCCAGCTACGAATCTCCGACCACCACTACAGCAAGGGCTTCAGGCAGGCCGCGTCAGTTGTTGT
GGCCATGGACAAGCTGAGGAAGATGCTGGTTCCCTGCCCACAGACCTTCCAGGAGAATGACCTGAGCACC
TTCTTTCCCTTCATCTTTGAAGAAGAACCTATCTTCTTCGACACATGGGATAACGAGGCTTATGTGCACG
ATGCACCTGTACGATCACTGAACTGCACGCTCCGGGACTCACAGCAAAAAAGCTTGGTGATGTCTGGTCC
ATATGAACTGAAAGCTCTCCACCTCCAGGGACAGGATATGGAGCAACAAGTGGTGTTCTCCATGTCCTTT
GTACAAGGAGAAGAAAGTAATGACAAAATACCTGTGGCCTTGGGCCTCAAGGAAAAGAATCTGTACCTGT
CCTGCGTGTTGAAAGATGATAAGCCCACTCTACAGCTGGAGAGTGTAGATCCCAAAAATTACCCAAAGAA
GAAGATGGAAAAGCGATTTGTCTTCAACAAGATAGAAATCAATAACAAGCTGGAATTTGAGTCTGCCCAG
TTCCCCAACTGGTACATCAGCACCTCTCAAGCAGAAAACATGCCCGTCTTCCTGGGAGGGACCAAAGGCG
GCCAGGATATAACTGACTTCACCATGCAATTTGTGTCTTCCTAAAGAGAGCTGTACCCAGAGAGTCCTGT
GCTGAATGTGGACTCAATCCCTAGGGCTGGCAGAAAGGGAACAGAAAGGTTTTTGAGTACGGCTATAGCC
TGGACTTTCCTGTTGTCTACACCAATGCCCAACTGCCTGCCTTAGGGTAGTGCTAAGAGGATCTCCTGTC
CATCAGCCAGGACAGTCAGCTCTCTCCTTTCAGGGCCAATCCCCAGCCCTTTTGTTGAGCCAGGCCTCTC
TCACCTCTCCTACTCACTTAAAGCCCGCCTGACAGAAACCACGGCCACATTTGGTTCTAAGAAACCCTCT
GTCATTCGCTCCCACATTCTGATGAGCAACCGCTTCCCTATTTATTTATTTATTTGTTTGTTTGTTTTAT
TCATTGGTCTAATTTATTCAAAGGGGGCAAGAAGTAGCAGTGTCTGTAAAAGAGCCTAGTTTTTAATAGC
TATGGAATCAATTCAATTTGGACTGGTGTGCTCTCTTTAAATCAAGTCCTTTAATTAAGACTGAAAATAT
ATAAGCTCAGATTATTTAAATGGGAATATTTATAAATGAGCAAATATCATACTGTTCAATGGTTCTGAAA
TAAACTTCACTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGCGGCCGC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000576 unedited
NGCCGTTCAAATTTGTAAACGACTCATATAGGCGGCCGCGNATTCCCGGGNAATCGTCGA
CCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGACCAAACCTCTTCGAGGCACAAGG
CACAACAGGCTGCTCTGGGATTCTCTTCAGCCAATCTTCATTGCTCAAGTGTCTGAAGCA
GCCATGGCAGAAGTACCTGAGCTCGCCAGTGAAATGATGGCTTATTACAGTGGCAATGAG
GATGACTTGTTCTTTGAAGCTGATGGCCCTAAACAGATGAAGTGCTCCTTCCAGGACCTG
GACCTCTGCCCTCTGGATGGCGGCATCCAGCTACGAATCTCCGACCACCACTACAGCAAG
GGCTTCAGGCAGGCCGCGTCAGTTGTTGTGGCCATGGACAAGCTGAGGAAGATGCTGGTT
CCCTGCCCACAGACCTTCCAGGAGAATGACCTGAGCACCTTCTTTCCCTTCATCTTTGAA
GAAGAACCTATCTTCTTCGACACATGGGATAACGAGGCTTATGTGCACGATGCACCTGTA
CGATCACTGAACTGCACGCTCCGGGACTCACAGCAAANAAGCTTGGTGATGTCTGGTCCA
TATGAACTGAAAGCTCTCCACCTCCAGGGACAGGATATGGAGCAACAAGTGGTGTTCTCC
ATGTCCTTTGTACAAGGAGAAGAAAGTAATGACAAAATACCTGTGGCCTTGGGCCTCAAG
GAAAAGAATCTGTACCTGTCCTGCGTGTTGAAAGATGATAAGCCCACTCTACAGCTGGAG
AGTGTAGATCCCAAAAATTACCCAAAGAAGAAGATGGAAAAGCGATTTGTCTTNCAACAG
ATAGAAATCAATAACAAGCTGGAATTNGAGTCTGCCCAGTTCCCCCACTGGTAC
Tag Tag Free
ACCN NM_000576
ORF Size 810 bp
Insert Size 1522
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000576.2, NP_000567
RefSeq Size 1498
Locus ID 3553
Cytogenetics 2q14.1
Protein Families Secreted Protein, Druggable Genome
Protein Pathways MAPK signaling pathway, Cytokine-cytokine receptor interaction, Apoptosis, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, Cytosolic DNA-sensing pathway, Hematopoietic cell lineage, Type I diabetes mellitus, Alzheimer's disease, Prion diseases, Graft-versus-host disease
Gene Summary The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. The induction of cyclooxygenase-2 (PTGS2/COX2) by this cytokine in the central nervous system (CNS) is found to contribute to inflammatory pain hypersensitivity. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations