Cytokeratin 10(KRT10) (NM_000421) Human Untagged Clone

CAT#: SC122561

KRT10 (untagged)-Human keratin 10 (KRT10)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cytokeratin 10(KRT10) (NM_000421) Human Untagged Clone
Symbol KRT10
Synonyms BCIE; BIE; CK10; EHK; K10; KPP
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000421 edited
CAGCATCACCATGTCTGTTCGATACAGCTCAAGCAAGCACTACTCTTCCTCCCGCAGTGG
AGGAGGAGGAGGAGGAGGAGGATGTGGAGGAGGAGGAGGAGTGTCATCCCTAAGAATTTC
TAGCAGCAAAGGCTCCCTTGGTGGAGGATTTAGCTCAGGGGGGTTCAGTGGTGGCTCTTT
TAGCCGTGGGAGCTCTGGTGGGGGCTGCTTTGGGGGCTCATCAGGTGGCTATGGAGGATT
AGGAGGTTTTGGTGGAGGTAGCTTTCGTGGAAGCTATGGAAGTAGCAGCTTTGGTGGGAG
TTATGGAGGCAGCTTTGGAGGGGGCAGTTTCGGAGGTGGCAGCTTTGGTGGGGGCAGCTT
TGGTGGAGGCGGCTTTGGTGGAGGCGGCTTTGGAGGAGGCTTTGGTGGTGGATTTGGAGG
AGATGGTGGCCTTCTCTCTGGAAATGAAAAAGTAACCATGCAGAATCTGAATGACCGCCT
GGCTTCCTACTTGGACAAAGTTCGGGCTCTGGAAGAATCAAACTATGAGCTGGAAGGCAA
AATCAAGGAGTGGTATGAAAAGCATGGCAACTCACATCAGGGGGAGCCTCGTGACTACAG
CAAATACTACAAAACCATCGATGACCTTAAAAATCAGATTCTCAACCTAACAACTGATAA
TGCCAACATCCTGCTTCAGATCGACAATGCCAGGCTGGCAGCTGATGACTTCAGGCTGAA
GTATGAGAATGAGGTAGCTCTGCGCCAGAGCGTGGAGGCTGACATCAACGGCCTGCGTAG
GGTGCTGGATGAGCTGACCCTGACCAAGGCTGACCTGGAGATGCAAATTGAGAGCCTGAC
TGAAGAGCTGGCCTATCTGAAGAAGAACCACGAGGAGGAAATGAAAGACCTTCGAAATGT
GTCCACTGGTGATGTGAATGTGGAAATGAATGCTGCCCCGGGTGTTGATCTGACTCAACT
TCTGAATAACATGAGAAGCCAATATGAACAACTTGCTGAACAAAACCGCAAAGATGCTGA
AGCCTGGTTCAATGAAAAGAGCAAGGAACTGACTACAGAAATTGATAATAACATTGAACA
GATATCCAGCTATAAATCTGAGATTACTGAATTGAGACGTAATGTACAAGCTCTGGAGAT
AGAACTACAGTCCCAACTGGCCTTGAAACAATCCCTGGAAGCCTCCTTGGCAGAAACAGA
AGGTCGCTACTGTGTGCAGCTCTCACAGATTCAGGCCCAGATATCCGCTCTGGAAGAACA
GTTGCAACAGATTCGAGCTGAAACCGAGTGCCAGAATACTGAATACCAACAACTCCTGGA
TATTAAGATCCGACTGGAGAATGAAATTCAAACCTACCGCAGCCTGCTAGAAGGAGAGGG
AAGTTCCGGAGGCGGCGGACGCGGCGGCGGAAGTTTCGGCGGCGGCTACGGCGGCGGAAG
CTCCGGCGGCGGAAGCTCCGGCGGCGGCTACGGCGGCGGCCACGGCGGCAGTTCCGGCGG
CGGCTACGGAGGCGGAAGCTCCGGCGGCGGAAGCTCCGGCGGCGGCTACGGGGGCGGAAG
CTCCAGCGGCGGCCACGGCGGCAGTTCCAGCGGCGGCTACGGTGGTGGCAGTTCCGGCGG
CGGCGGCGGCGGCTACGGGGGCGGCAGCTCCGGCGGCGGCAGCAGCTCCGGCGGCGGATA
CGGCGGCGGCAGCTCCAGCGGAGGCCACAAGTCCTCCTCTTCCGGGTCCGTGGGCGAGTC
TTCATCTAAGGGACCAAGATACTAACAAAACCAGAGTAATCAAGACAATTATTGAAGAGG
TGGCGCCCGACGGTAGAGTTCTTTCATCTATGGTTGAATCAGAAACCAAGAAACACTACT
ATTAAACTGCATCAAGAGGAGAGAGTCTCCCTTCACACAGACCATTATTTACAGATGCAT
GGAAAACAAAGTCTCCAAGAAAACACTTCTGTCTTGATGGTCTATGGAAATAGACCTTGA
AAATAAGGTGTCTACAAGGTGTTTTGTGGTTTCTGTATTTCTTCTTTTCACTTTACCAGA
AAGTGTTCTTTAATGGAAAGAAAAACAACTTTCTGTTCTCATTTACTAATGAATTTCAAT
AAACTTTCTTACTGATGCAAACTAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000421 unedited
NGGGATTGGGGNNGAAAACCACNCTCTTAGGGCGGCCGCGATTCCCGGGATCAGCATCAC
CATGTCTGTTCGATACAGCTCAAGCAAGCACTACTCTTCCTCCCGCAGTGGAGGAGGAGG
AGGAGGAGGAGGATGTGGAGGAGGAGGAGGAGTGTCATCCCTAAGAATTTCTAGCAGCAA
AGGCTCCCTTGGTGGAGGATTTAGCTCAGGGGGGTTCAGTGGTGGCTCTTTTAGCCGTGG
GAGCTCTGGTGGGGGCTGCTTTGGGGGCTCATCAGGTGGCTATGGAGGATTAGGAGGTTT
TGGTGGAGGTAGCTTTCGTGGAAGCTATGGAAGTAGCAGCTTTGGTGGGAGTTATGGAGG
CAGCTTTGGAGGGGGCAGTTTCGGAGGTGGCAGCTTTGGTGGGGGCAGCTTTGGTGGAGG
CGGCTTTGGTGGAGGCGGCTTTGGAGGAGGCTTTGGTGGTGGATTTGGAGGAGATGGTGG
CCTTCTCTCTGGAAATGAAAAAGTAACCATGCAGAATCTGAATGACCGCCTGGCTTCCTA
CTTGGACAAAGTTCGGGCTCTGGAAGAATCAAACTATGAGCTGGAAGGCAAAATCAAGGA
GTGGTATGAAAAGCATGGCAACTCACATCAGGGGGAGCCTCGTGACTACAGCAAATACTA
CAAAACCATCGATGACCTTAAAAATCAGATTCTCAACCTAACAACTGATAATGCCAACAT
CCTGCTTCAGATCGACAATGCCAGGCTGGCAGCTGATGACTTCAGGCTGAAGTATGAGAA
TGAGGTAGCTCTGCGCCAGAGCGTGGAGGCTGACATCAACGGCCTGCGTANGGTGCTGGA
TGAGCTGACCCCTGACCAAGCTGACCTGNAGATGCANATTGAGAGCCTGACTGNNAGAGC
TGCCCTATCTGAGAAGAACCACGAGA
Tag Tag Free
ACCN NM_000421
ORF Size 1755 bp
Insert Size 2145
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000421.2, NP_000412
RefSeq Size 2145
RefSeq ORF 1755
Locus ID 3858
Cytogenetics 17q21.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.