BCL2 (BC027258) Human Untagged Clone

CAT#: SC122225

Reviews ()
Write a review

BCL2 (untagged)-Human B-cell CLL/lymphoma 2, transcript variant alpha (cDNA clone MGC:21366 IMAGE:4511027), complete cds



USD 477.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BCL2
Synonyms B-cell CLL/lymphoma 2; B-cell lymphoma protein 2; Bcl-2; OTTHUMP00000163680
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for BC027258 edited
CTGGAGAGTGCTGAAGATTGATGGGATCGTTGCCTTATGCATTTGTTTTGGTTTTACAAA
AAGGAAACTTGACAGAGGATCATGCTGTACTTAAAAAATACAACATCACAGAGGAAGTAG
ACTGATATTAACAATACTTACTAATAATAACGTGCCTCATGAAATAAAGATCCGAAAGGA
ATTGGAATAAAAATTTCCTGCATCTCATGCCAAGGGGGAAACACCAGAATCAAGTGTTCC
GCGTGATTGAAGACACCCCCTCGTCCAAGAATGCAAAGCACATCCAATAAAATAGCTGGA
TTATAACTCCTCTTCTTTCTCTGGGGGCCGTGGGGTGGGAGCTGGGGCGAGAGGTGCCGT
TGGCCCCCGTTGCTTTTCCTCTGGGAAGGATGGCGCACGCTGGGAGAACGGGGTACGATA
ACCGGGAGATAGTGATGAAGTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGG
ATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCT
CCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGC
CGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCAC
CTGTGGTCCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCG
ACTTCGCCGAGATGTCCAGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTG
CCACGGTGGTGGAGGAGCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCTTCT
TTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGG
ACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGG
ATAACGGAGGCTGGGATGCCTTTGTGGAACTGTACGGCCCCAGCATGCGGCCTCTGTTTG
ATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTGGTGGGAGCTTGCATCA
CCCTGGGTGCCTATCTGGGCCACAAGTGAAGTCAACATGCCTGCCCCAAACAAATATGCA
AAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGTACCATGAAACAAAG
CTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACA
CACACACACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAA
GGGAAATATCATTTATTTTTTACATTATTAAGAAAAAAAGATTTATTTATTTAAGACAGT
CCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCACCGCTTCGTGTG
GCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGA
TCACCATCTGAAGAGCAGACGGATGGAAAAAGGACCTGATCATTGGGGAAGCTGGCTTTC
TGGCTGCTGGAGGCTGGGGAGAAGGTGTTCATTCACTTGCATTTCTTTGCCCTGGGGGCT
GTGATATTAACAGAGGGAGGGTTCCTGTGGGGGGAAGTCCATGCCTCCCTGGCCTGAAGA
AGAGACTCTTTGCATATGACTCACATGATGCATACCTGGTGGGAGGAAAAGAGTTGGGAA
CTTCAGATGGACCTAGTACCCACTGAGATTTCCACGCCGAAGGACAGCGATGGGAAAAAT
GCCCTTAAATCATAGGAAAGTATTTTTTTAAGCTACCAATTGTGCCGAGAAAAGCATTTT
AGCAATTTATACAATATCATCCAGTACCTTAAGCCCTGATTGTGTATATTCATATATTTT
GGATACGCACCCCCCAACTCCCAATACTGGCTCTGTCTGAGTAAGAAACAGAATCCTCTG
GAACTTGAGGAAGTGAACATTTCGGTGACTTCCGCATCAGGAAGGCTAGAGTTACCCAGA
GCATCAGGCCGCCACAAGTGCCTGCTTTTAGGAGACCGAAGTCCGCAGAACCTGCCTGTG
TCCCAGCTTGGAGGCCTGGTCCTGGAACTGAGCCGGGGCCCTCACTGGCCTCCTCCAGGG
ATGATCAACAGGGCAGTGTGGTCTCCGAATGTCTGGAAGCTGATGGAGCTCAGAATTCCA
CTGTCAAGAAAGAGCAGTAGAGGGGTGTGGCTGGGCCTGTCACCCTGGGGCCCTCCAGGT
AGGCCCGTTTTCACGTGGAGCATGGGAGCCACGACCCTTCTTAAGACATGTATCACTGTA
GAGGGAAGGAACAGAGGCCCTGGGCCCTTCCTATCAGAAGGACATGGTGAAGGCTGGGAA
CGTGAGGAGAGGCAATGGCCACGGCCCATTTTGGCTGTAGCACATGGCACGTTGGCTGTG
TGGCCTTGGCCCACCTGTGAGTTTAAAGCAAGGCTTTAAATGACTTTGGAGAGGGTCACA
AATCCTAAAAGAAGCATTGAAGTGAGGTGTCATGGATTAATTGACCCCTGTCTATGGAAT
TACATGTAAAACATTATCTTGTCACTGTAGTTTGGTTTTATTTGAAAACCTGACAAAAAA
AAAGTTCCAGGTGTGGAATATGGGGGTTATCTGTACATCCTGGGGCATTAAAAAAAAAAA
AAAA
>OriGene 5' read for BC027258 unedited
GGCCAGTTCGNTTTTGTATACGACTCACTATAGGCGGCCGCGTATTCAGATCTGGTACCG
GTCCGGAATTCCCGGGATATCGTCGACCCACGCGTCCGCTGGAGAGTGCTGAAGATTGAT
GGGATCGTTGCCTTATGCATTTGTTTTGGTTTTACAAAAAGGAAACTTGACAGAGGATCA
TGCTGTACTTAAAAAATACAACATCACAGAGGAAGTAGACTGATATTAACAATACTTACT
AATAATAACGTGCCTCATGAAATAAAGATCCGAAAGGAATTGGAATAAAAATTTCCTGCA
TCTCATGCCAAGGGGGAAACACCAGAATCAAGTGTTCCGCGTGATTGAAGACACCCCCTC
GTCCAAGAATGCAAAGCACATCCAATAAAATAGCTGGATTATAACTCCTCTTCTTTCTCT
GGGGGCCGTGGGGTGGGAGCTGGGGCGAGAGGTGCCGTTGGCCCCCGTTGCTTTTCCTCT
GGGAAGGATGGCGCACGCTGGGAGAACGGGGTACGATAACCGGGAGATAGTGATGAAGTA
CATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGC
GCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCA
TCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCC
CGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCG
CCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCA
GCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTT
CAGGGACGGG
Restriction Sites Please inquire     
ACCN BC027258
Insert Size 2704 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC027258.1, AAH27258.1
RefSeq Size 2704 bp
RefSeq ORF 717 bp
Locus ID 596
Cytogenetics 18q21.33
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Stem cell - Pluripotency, Transmembrane
Protein Pathways Amyotrophic lateral sclerosis (ALS), Apoptosis, Colorectal cancer, Focal adhesion, Neurotrophin signaling pathway, Pathways in cancer, Prostate cancer, Small cell lung cancer
Gene Summary This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Other products for "BCL2"
Frequently bought together (4)
BCL2 mouse monoclonal antibody, clone OTI9D3 (formerly 9D3)
    • 100 ul

USD 417.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.