CYBB(CYBB) (NM_000397) Human Untagged Clone

CAT#: SC122091

CYBB (untagged)-Human cytochrome b-245, beta polypeptide (CYBB)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CYBB(CYBB) (NM_000397) Human Untagged Clone
Symbol CYBB
Synonyms AMCBX2; CGD; GP91-1; GP91-PHOX; GP91PHOX; IMD34; NOX2; p91-PHOX
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC122091 sequence for NM_000397 edited (data generated by NextGen Sequencing)
ATGGGGAACTGGGCTGTGAATGAGGGGCTCTCCATTTTTGTCATTCTGGTTTGGCTGGGG
TTGAACGTCTTCCTCTTTGTCTGGTATTACCGGGTTTATGATATTCCACCTAAGTTCTTT
TACACAAGAAAACTTCTTGGGTCAGCACTGGCACTGGCCAGGGCCCCTGCAGCCTGCCTG
AATTTCAACTGCATGCTGATTCTCTTGCCAGTCTGTCGAAATCTGCTGTCCTTCCTCAGG
GGTTCCAGTGCGTGCTGCTCAACAAGAGTTCGAAGACAACTGGACAGGAATCTCACCTTT
CATAAAATGGTGGCATGGATGATTGCACTTCACTCTGCGATTCACACCATTGCACATCTA
TTTAATGTGGAATGGTGTGTGAATGCCCGAGTCAATAATTCTGATCCTTATTCAGTAGCA
CTCTCTGAACTTGGAGACAGGCAAAATGAAAGTTATCTCAATTTTGCTCGAAAGAGAATA
AAGAACCCTGAAGGAGGCCTGTACCTGGCTGTGACCCTGTTGGCAGGCATCACTGGAGTT
GTCATCACGCTGTGCCTCATATTAATTATCACTTCCTCCACCAAAACCATCCGGAGGTCT
TACTTTGAAGTCTTTTGGTACACACATCATCTCTTTGTGATCTTCTTCATTGGCCTTGCC
ATCCATGGAGCTGAACGAATTGTACGTGGGCAGACCGCAGAGAGTTTGGCTGTGCATAAT
ATAACAGTTTGTGAACAAAAAATCTCAGAATGGGGAAAAATAAAGGAATGCCCAATCCCT
CAGTTTGCTGGAAACCCTCCTATGACTTGGAAATGGATAGTGGGTCCCATGTTTCTGTAT
CTCTGTGAGAGGTTGGTGCGGTTTTGGCGATCTCAACAGAAGGTGGTCATCACCAAGGTG
GTCACTCACCCTTTCAAAACCATCGAGCTACAGATGAAGAAGAAGGGGTTCAAAATGGAA
GTGGGACAATACATTTTTGTCAAGTGCCCAAAGGTGTCCAAGCTGGAGTGGCACCCTTTT
ACACTGACATCCGCCCCTGAGGAAGACTTCTTTAGTATCCATATCCGCATCGTTGGGGAC
TGGACAGAGGGGCTGTTCAATGCTTGTGGCTGTGATAAGCAGGAGTTTCAAGATGCGTGG
AAACTACCTAAGATAGCGGTTGATGGGCCCTTTGGCACTGCCAGTGAAGATGTGTTCAGC
TATGAGGTGGTGATGTTAGTGGGAGCAGGGATTGGGGTCACACCCTTCGCATCCATTCTC
AAGTCAGTCTGGTACAAATATTGCAATAACGCCACCAATCTGAAGCTCAAAAAGATCTAC
TTCTACTGGCTGTGCCGGGACACACATGCCTTTGAGTGGTTTGCAGATCTGCTGCAACTG
CTGGAGAGCCAGATGCAGGAAAGGAACAATGCCGGCTTCCTCAGCTACAACATCTACCTC
ACTGGCTGGGATGAGTCTCAGGCCAATCACTTTGCTGTGCACCATGATGAGGAGAAAGAT
GTGATCACAGGCCTGAAACAAAAGACTTTGTATGGACGGCCCAACTGGGATAATGAATTC
AAGACAATTGCAAGTCAACACCCTAATACCAGAATAGGAGTTTTCCTCTGTGGACCTGAA
GCCTTGGCTGAAACCCTGAGTAAACAAAGCATCTCCAACTCTGAGTCTGGCCCTCGGGGA
GTGCATTTCATTTTCAACAAGGAAAACTTCTAA

Clone variation with respect to NM_000397.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000397 unedited
NNNCCGTCAAAATTTGTATACGACTCCTATAGGGCGGCCGCGATTCGGCACCAGTCAACC
TCTGCCACCATGGGGAACTGGGCTGTGAATGAGGGGCTCTCCATTTTTGTCATTCTGGTT
TGGCTGGGGTTGAACGTCTTCCTCTTTGTCTGGTATTACCGGGTTTATGATATTCCACCT
AAGTTCTTTTACACAAGAAAACTTCTTGGGTCAGCACTGGCACTGGCCAGGGCCCCTGCA
GCCTGCCTGAATTTCAACTGCATGCTGATTCTCTTGCCAGTCTGTCGAAATCTGCTGTCC
TTCCTCAGGGGTTCCAGTGCGTGCTGCTCAACAAGAGTTCGAAGACAACTGGACAGGAAT
CTCACCTTTCATAAAATGGTGGCATGGATGATTGCACTTCACTCTGCGATTCACACCATT
GCACATCTATTTAATGTGGAATGGTGTGTGAATGCCCGAGTCAATAATTCTGATCCTTAT
TCAGTAGCACTCTCTGAACTTGGAGACAGGCAAAATGAAAGTTATCTCAATTTTGCTCGA
AAGAGAATAAAGAACCCTGAAGGAGGCCTGTACCTGGCTGTGACCCTGTTGGCAGGCATC
ACTGGAGTTGTCATCACGCTGTGCCTCATATTAATTATCACTTCCTCCACCAAAACCATC
CGGAGGTCTTACTTTGAAGTCTTTTGGTACACACATCATCTCTTTGTGATCTTCTTCATT
GGCCTTGCCATCCATGGAGCTGAACGAATTGTACGTGGGCAGACCGCAGAGAGTTTTGGC
TGTGCATAATATAACAGTTTGTGAACAAAAATCTCAGATGGGGAANAATAAGGATGCCCA
TCCCTCAGTTGCTGGAACCCTCTATACTNGAATGATATAGTGGTCCATGGTTTGT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000397 unedited
CTTAAATTAGCCTGCTTTCTTTTATAGCACAGGAAGCAGGACTAGCATGAGCCATAGTCA
TGGCAGGAGGTTAATTCTCCACCTCCAACCCTCTTTTTTCATGCTTCAAATAAGAATGTG
CAGAACCCTTCAGGCAATCCTATTGGTTAGTATCCTTAGCCTGTTCTTGACCCTAGGGAG
AATCAGATTCCTTTGGTCTATGACAGTAATAGAAGTTATTTCTTTAGATAAATTTTGTTT
AAGGCTTTAAATTAATTCTATCTTGGCATTGTGTGGTTCTAAATTCATTCATTCATTTAA
CAAAACTTACTTGAGTATCCGCTCTCTGCCAAGCACAGTGGTAAATGATGAGTATTACAT
TAACTCCAATCAATCCAATATTCTTCTGTAGAAAGAACATCTGGCCCAGTTACCCTGCTG
TATTAGTAAACTGGAGTATGCTCAGATGTCAATACTGTCACTAATAAGTGTTGAGACACT
CTCAACATGTATTATGTCCTAATGATCTGGAAAATTTCCTTCAGTATGATAATAATGATG
GCAAAAATGACACANAGTAGAAATATATAGCTACTCCTTGGTTTCCTTCTTCTTTTGGGG
AATATAAAAACTGATTTTGAGGATTCTGAGGCAGCTCAGTATTGTGGAAAGAGTATCAAA
CCTGGAGTAAGATGGGCTAGATCTGGTCACAGTTTCATAATCTTANGGAAGTTACTGAAA
CCTTTGATCCTTTCCCTTTTGATTCTAAAATTGAGTCCAAGAAATCTTTTCCCTACTTCA
CTGACATTACTGAGAGGAAAAAATGAAATACTGCTTGAAAAGTGCTCTCAAAACATAGAG
CTCCCATAAATGTAACTTATCACTATCAAACAATCTTTGACATTCCNTTNAGGGGAAACC
CATACATNATAGTTTCTTTTTGGTCCTTTTTAAAC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000397
ORF Size 1713 bp
Insert Size 3000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000397.2, NP_000388
RefSeq Size 4266
Locus ID 1536
Cytogenetics Xp21.1-p11.4
Domains Ferric_reduct
Protein Families Ion Channels: Other, Transmembrane, Druggable Genome
Protein Pathways Leukocyte transendothelial migration
Gene Summary Critical component of the membrane-bound oxidase of phagocytes that generates superoxide. It is the terminal component of a respiratory chain that transfers single electrons from cytoplasmic NADPH across the plasma membrane to molecular oxygen on the exterior. Also functions as a voltage-gated proton channel that mediates the H(+) currents of resting phagocytes. It participates in the regulation of cellular pH and is blocked by zinc. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.