GRIK2 (NM_021956) Human Untagged Clone

CAT#: SC121951

GRIK2 (untagged)-Human glutamate receptor, ionotropic, kainate 2 (GRIK2), transcript variant 1


  "NM_021956" in other vectors (6)

Reconstitution Protocol

USD 832.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "GRIK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GRIK2
Synonyms EAA4; GLR6; GluK2; GLUK6; GLUR6; MRT6
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_021956 edited
GGGCGGCCGCGAATTCGGCACGAGCCTCGTGCCGAATTCGGCACGAGGCTTTTCCGCCCG
ACCTCCTCCGGCTGCTCCTCCCCGAGGACCACCCCACCCCCTCCCCGCCCACCTCACCCC
TAGCTCCAGGCTCGCGCGGCCGGACATTGTGGGTGTGCGTGCTGGATTTCTCCCGGATGC
TCTCCGACTAACATGGATGTCCCACCATTCCTTGCAGTGGAAGGTTGTTCCTTGGCGCAG
TGAGTGAAGAACATGCAGCGATTGCTAATGGGTTTGGGAAGCGGAGACTCCTTCCTCTCT
CTATGACCATGCCGTGATCGTGTCTGCGGTCACCACTCGACGCATCCTCATTTCTACCCG
AACCCAGGAGCCGAACGCTAGATCGGGGAAGTGGGTGCCGTGCGTGTGGGCACAGAAACA
CCATGAAGATTATTTTCCCGATTCTAAGTAATCCAGTCTTCAGGCGCACCGTTAAACTCC
TGCTCTGTTTACTGTGGATTGGATATTCTCAAGGAACCACACATGTATTAAGATTTGGTG
GTATTTTTGAATATGTGGAATCTGGCCCAATGGGAGCTGAGGAACTTGCATTCAGATTTG
CTGTGAACACAATTAACAGAAACAGAACATTGCTACCCAATACTACCCTTACCTATGATA
CCCAGAAGATAAACCTTTATGATAGTTTTGAAGCATCCAAGAAAGACCTTTATCTCCTCT
TCAGCCTGTGATCAGCTGTCTCTTGGGGTGGCTGCCATCTTCGGGCCTTCACACAGCTCA
TCAGCAAACGCAGTGCAGTCCATCTGCAATGCTCTGGGAGTTCCCCACATACAGACCCGC
TGGAAGCACCAGGTGTCAGACAACAAAGATTCCTTCTATGTCAGTCTCTACCCAGACTTC
TCTTCACTCAGCCGTGCCATTTTAGACCTGGTGCAGTTTTTCAAGTGGAAAACCGTCACG
GTTGTGTATGATGACAGCACTGGTCTCATTCGTTTGCAAGAGCTCATCAAAGCTCCATCA
AGGTATAATCTTCGACTCAAAATTCGTCAGTTACCTGCTGATACAAAGGATGCAAAACCC
TTACTAAAAGAAATGAAAAGAGGCAAGGAGTTTCATGTAATCTTTGATTGTAGCCATGAA
ATGGCAGCAGGCATTTTAAAACAGGCATTAGCTATGGGAATGATGACAGAATACTATCAT
TATATCTTTACCACTCTGGACCTCTTTGCTCTTGATGTTGAGCCCTACCGATACAGTGGT
GTTAACATGACAGGGTTCAGAATATTAAATACAGAAAATACCCAAGTCTCCTCCATCATT
GAAAAGTGGTCGATGGAACGATTGCAGGCACCTCCGAAACCCGATTCAGGTTTGCTGGAT
GGATTTATGACGACTGATGCTGCTCTAATGTATGATGCTGTGCATGTGGTGTCTGTGGCC
GTTCAACAGTTTCCCCAGATGACAGTCAGTTCCTTGCAGTGTAATCGACATAAACCCTGG
CGCTTCGGGACCCGCTTTATGAGTCTAATTAAAGAGGCACATTGGGAAGGCCTCACAGGC
AGAATAACTTTCAACAAAACCAATGGCTTGAGAACAGATTTTGATTTGGATGTGATCAGT
CTGAAGGAAGAAGGTCTAGAAAAGATTGGAACGTGGGATCCAGCCAGTGGCCTGAATATG
ACAGAAAGTCAAAAGGGAAAGCCAGCGAACATCACAGATTCGTTATCCAATCGTTCTTTG
ATTGTTACCACCATTTTGGAAGAGCCTTATGTCCTTTTTAAGAAGTCTGACAAACCTCTC
TATGGTAATGATCGATTTGAAGGCTATTGCATTGATCTCCTCAGAGAGTTATCTACAATC
CTTGGCTTTACATATGAAATTAGACTTGTGGAAGATGGGAAATATGGAGCCCAGGATGAT
GCCAATGGACAATGGAATGGAATGGTTCGTGAACTAATTGATCATAAAGCTGACCTTGCA
GTTGCTCCACTGGCTATTACCTATGTTCGAGAGAAGGTCATCGACTTTTCCAAGCCCTTT
ATGACACTTGGAATAAGTATTTTGTACCGCAAGCCCAATGGTACAAACCCAGGCGTCTTC
TCCTTCCTGAATCCTCTCTCCCCTGATATCTGGATGTATATTCTGCTGGCTTGCTTGGGT
GTCAGTTGTGTGCTCTTTGTCATAGCCAGGTTTAGTCCTTATGAGTGGTATAATCCACAC
CCTTGCAACCCTGACTCAGACGTGGTGGAAAACAATTTTACCTTGCTAAATAGTTTCTGG
TTTGGAGTTGGAGCTCTCATGCGGCAAGGTTCTGAGCTCATGCCCAAAGCACTGTCCACC
AGGATAGTGGGAGGCATTTGGTGGTTTTTCACACTTATCATCATTTCTTCGTATACTGCT
AACTTAGCCGCCTTTCTGACAGTGGAACGCATGGAATCCCCTATTGACTCTGCTGATGAT
TTAGCTAAACAAACCAAGATAGAATATGGAGCAGTAGAGGATGGTGCAACCATGACTTTT
TTCAAGAAATCAAAAATCTCCACGTATGACAAAATGTGGGCCTTTATGAGTAGCAGAAGG
CAGTCAGTGCTGGTCAAAAGTAATGAAGAAGGAATCCAGCGAGTCCTCACCTCTGATTAT
GCTTTCCTAATGGAGTCAACAACCATCGAGTTTGTTACCCAGCGGAACTGTAACCTGACA
CAGATTGGCGGCCTTATAGACTCTAAAGGTTATGGCGTTGGCACTCCCATGGGTTCTCCA
TATCGAGACAAAATTACCATAGCAATTCTTCAGCTGCAAGAGGAAGGCAAACTGCATATG
ATGAAGGAGAAATGGTGGAGGGGCAATGGTTGCCCAGAAGAGGAGAGCAAAGAGGCCAGT
GCCCTGGGGGTTCAGAATATTGGTGGCATCTTCATTGTTCTGGCAGCCGGCTTGGTGCTT
TCAGTTTTTGTGGCAGTGGGAGAATTTTTATACAAATCCAAAAAAAACGCTCAATTGGAA
AAGAGGTCCTTCTGTAGTGCCATGGTAGAAGAATTGAGGATGTCCCTGAAGTGCCAGCGT
CGGTTAAAACATAAGCCACAGGCCCCAGTTATTGTGAAAACAGAAGAAGTTATCAACATG
CACACATTTAACGACAGAAGGTTGCCAGGTAAAGAAACCATGGCATAAAGCTGGGAGGCC
AAACACCCAAGCACAAACTGTCGTCTTTTTCCAAACAATTTAGCCAGAATGTTTCCTGTG
GAAATATGCAACCTGTGCAAAATAAAATGAGTTACCTCATGCCGCTGTGTCTATGAACTA
GAGACTCTGTGATCTAAGCAGTTGCAATGATCAGACTTGATTTACAAGCATCATGGATCA
ACCAAGTTACACGGGGTTACACTGTTAATCATGGGTTCCTCCCTTCTTCTGAGTGAATGT
TAACATGCGCATTTTGTGGCTGATTTCAAATGCAGTCCAGTGAGAAATTACAGGTTCCTT
TTGAAGCTCAACTGTTGCCAGGAGATGGAATATCAATGCCCAACAGGGCAACCAA
>OriGene 5' read for NM_021956 unedited
AGTCAAAATTTGTATACGACTCACTATAGGGCGGCCGCGAATTCGCACGAGCCTCGTGCC
GAATTCGGCACGAGGCTTTTCCGCCCGACCTCCTCCGGCTGCTCCTCCCCGAGGACCACC
CCACCCCCTCCCCGCCCACCTCACCCCTAGCTCCAGGCTCGCGCGGCCGGACATTGTGGG
TGTGCGTGCTGGATTTCTCCCGGATGCTCTCCGACTAACATGGATGTCCCACCATTCCTT
GCAGTGGAAGGTTGTTCCTTGGCGCAGTGAGTGAAGAACATGCAGCGATTGCTAATGGGT
TTGGGAAGCGGAGACTCCTTCCTCTCTCTATGACCATGCCGTGATCGTGTCTGCGGTCAC
CACTCGACGCATCCTCATTTCTACCCGAACCCAGGAGCCGAACGCTAGATCGGGGAAGTG
GGTGCCGTGCGTGTGGGCACAGAAACACCATGAAGATTATTTTCCCGATTCTAAGTAATC
CAGTCTTCAGGCGCACCGTTAAACTCCTGCTCTGTTTACTGTGGATTGGATATTCTCAAG
GAACCACACATGTATTAAGATTTGGTGGTATTTTTGAATATGTGGAATCTGGCCCAATGN
GAGCTGAGGAACTTGCATTCAGATTTGCTGTGAACACAATTAACAGAAACAGAACATTGC
TACCCAATACTACCCTTACCTATGATACCCAGAAGATAAACCTTTATGATAGTTTTGAAG
CATCCAAGAAAGCCTGTGATCAGCTGTCTCTTGGGGTGGCTGCCATCTTTCGGGCCTTCA
CCAGCTCATCAGCAAACGCAGTGCAGTCCATCTGCAATGCTCTGGGAGTTTCCCACATAC
AGACCCGCTGGAAACACCAGTGTTAGACAACAAAGATTCTCTCTATAGTAGGTTTTACCA
GAACTTTTTTTCATCAGCCGGGCCATTTT
>OriGene 3' read for NM_021956 unedited
TTAAAAGGGTTTACTACTTGNACCGCAGACCGCAATCNANGATCGATTTTTTTTCTTTTT
TTTTATATTCTTAGTGACACTTTTATTGGTTGCCCTGTTGGGCATTGATATTCCATCTCC
TGGCAACAGTTGAGCTTCAAAAGGAACCTGTAATTTCTCACTGGACTGCATTTGAAATCA
GCCACAAAATGCGCATGTTAACATTCACTCAGAAGAAAGGAGGAACCCATGATTTTCAGT
GTAACCCCGTGTAACTTGGTTGATCCATGATGCTTGTAAATCAAGTCTGATCATTGCAAC
TGCTTAGATCACAGAGTCTCTAGTTCATAGACACAGCGGCATGAAGTAACTCATTTTATT
TTGCACAGGGTGCATATTTCCACAGGAAACATTCTGGCTAAATTGTTTGGAAAAAGAGAC
AGTTTGTGCTTGGGTGTTTGCCCTCCAGCTTATGCCTGGTTTCTTTACCTGGCAACCTTT
GTCGTAAAGGTGGCCATGTGAAACTTCTTCTGGTTTCACAAAACTGGGCCCTGGGCTTAA
GTTTAACCGACCCTGGACCTTAAGGAACTCTAATTTTTTACCATGGCCTCAAAAGGACCC
TTTTTCATTGACCTTTTTTTTGGATTTGATAAAAATTCCCCCGGCCCCAAACTGAAACCC
CAGCCGGGTGCAAAAAATGAAAGCCCCCATTTTTGAACCCCAGGGCCTGGCTTTTTGTTT
CTTTTTGGAAACTTTGCCCCCCCTTTTTCTTTTAATAGGAGTGCTTCCTTTCCCCTAAAA
AATCCGGGAATTTTGCCCTTTGGAACCCGGGGGGGCCCCTTTCCCTTTAGTTAAGGCCCA
ATTGGGAGGGCAACCCCGGGGAAACCCTGGGGTGGGCCCTTTGAAAAATTCAGGGGGGAA
CGGGACTCTTTTTTTTTTGAACCCAA
Restriction Sites NotI-NotI     
ACCN NM_021956
Insert Size 3460 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021956.2, NP_068775.1
RefSeq Size 3322 bp
RefSeq ORF 2727 bp
Locus ID 2898
UniProt ID Q13002
Cytogenetics 6q16.3
Domains lig_chan, ANF_receptor
Protein Families Druggable Genome, Ion Channels: Glutamate Receptors, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. Mutations in this gene have been associated with autosomal recessive cognitive disability. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1). RNA editing changes Ile567Val, Tyr571Cys and Gln621Arg. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.