GTP cyclohydrolase 1 (GCH1) (NM_000161) Human Untagged Clone

CAT#: SC120083

Reviews ()
Write a review

GCH1 (untagged)-Human GTP cyclohydrolase 1 (GCH1), transcript variant 1



  "NM_000161" in other vectors (7)

Reconstitution Protocol

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "GCH1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GCH1
Synonyms DYT5; DYT5a; DYT14; GCH; GTP-CH-1; GTPCH1; HPABH4B
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC120083 sequence for NM_000161 edited (data generated by NextGen Sequencing)
ATGGAGAAGGGCCCTGTGCGGGCACCGGCGGAGAAGCCGCGGGGCGCCAGGTGCAGCAAT
GGGTTCCCCGAGCGGGATCCGCCGCGGCCCGGGCCCAGCAGGCCGGCGGAGAAGCCCCCG
CGGCCCGAGGCCAAGAGCGCGCAGCCCGCGGACGGCTGGAAGGGCGAGCGGCCCCGCAGC
GAGGAGGATAACGAGCTGAACCTCCCTAACCTGGCAGCCGCCTACTCGTCCATCCTGAGC
TCGCTGGGCGAGAACCCCCAGCGGCAAGGGCTGCTCAAGACGCCCTGGAGGGCGGCCTCG
GCCATGCAGTTCTTCACCAAGGGCTACCAGGAGACCATCTCAGATGTCCTAAACGATGCT
ATATTTGATGAAGATCATGATGAGATGGTGATTGTGAAGGACATAGACATGTTTTCCATG
TGTGAGCATCACTTGGTTCCATTTGTTGGAAAGGTCCATATTGGTTATCTTCCTAACAAG
CAAGTCCTTGGCCTCAGCAAACTTGCGAGGATTGTAGAAATCTATAGTAGAAGACTACAA
GTTCAGGAGCGCCTTACAAAACAAATTGCTGTAGCAATCACGGAAGCCTTGCGGCCTGCT
GGAGTCGGGGTAGTGGTTGAAGCAACACACATGTGTATGGTAATGCGAGGTGTACAGAAA
ATGAACAGCAAAACTGTGACCAGCACAATGTTGGGTGTGTTCCGGGAGGATCCAAAGACT
CGGGAAGAGTTCCTGACTCTCATTAGGAGCTGA

Clone variation with respect to NM_000161.2
>OriGene 5' read for NM_000161 unedited
GCGGCAACGCAATTCGCACGAGGCCCGGCTCGGTATGTGATCTAAGCAGGTCGCGTACCT
TCCTCAGGTGACTCCGGCCACAGCCCATTGTCCGCGGCCACCGGCGGAGTTTAGCCGCAG
ACCTCGAAGCGCCCCGGGGTCCTTCCCGAACGGCAGCGGCTGCGGCGGGTCCATGGAGAA
TGGCTCNGTGCGGGCACCGGCGGAGAAGCCGCGGGGCGCCAGGTGCAGCAATGGGTTCCC
CGAGCGGGATCCGCCGCGGCCCGGGCCCATCAGGCCGGCGGAGAAGCCCCCGCGGCCCGA
GGCCAAGAGCGCGCAGCCCGCGGACGGCTGGAAGGGCGAGCGGCCCCGCAGCGAGGAGGA
TAACGAGCTGAACCTCCCTAACCTGGCAGCCGCCTACTCGTCCATCCTGAGCTCGCTGGG
CGAGAACCCCCAGCGGCAAGGGCTGCTCAAGACGCCCTGGAGGGCGGCCTCGGCCATGCA
GTTCTTCACCAAGGGCTACCAGGAGACCATCTCAGATGTCCTAAACGATGCTATATTTGA
TGAAGATCATGATGAGATGGTGATTGTGAAGGACATAGACATGTTTTCCATGTGTGAGCA
TCACTTGGTTCCATTTGTTGGAAAGGTCCATATTGGTTATCTTCCTAACAGCAAGTCCTT
GGCCTCAGCAAACTTGCGAGGATTGTAGAAATCTATAGTAGAAGACTACCAGTTCAGGAG
CGCCTTACAAAACACATGGCTGTAGCAATCACGGAAGCCTTGCGGCCTGCTGGAGTCCGC
GTAGTGGTTGAAGCAACACACATGTGTTTGGTAATGCGAGGTGTACACAAAATGACCAGC
ANACTGTGACCAGCACAATGTTGGGTGTGTTCCCGGGAGGACC
>OriGene 3' read for NM_000161 unedited
AATGNNACCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTAAGTTACAATA
GTTTAATAATTTAAATAGGACCAACTTCAGGAACATACATACTCATACATAAAATTAAAC
AATTTAATTTTGAACAGTGTATTGAAATACATCAAATTCTTAAAAATCCCCCAAATGGAC
TCAAGATCATGGATATGAAAAGGTAATTTTGAAGTACTAAAGACTAGAGTAAAACAGACA
AAGTCATTACTTTGCATTTACTAATAAGACAACAGCCTGTGGATACATTAGACCTTTATA
AGAACACTTCTAGGAAATGTTAGAACAACGAGTCATTAAAAAGGAATATAAATGAGTTCA
TAAAGATAAATGTATAGCTGACAATTTCTTTGGTCCTCGAAGTCACACTTGTTTTTACTT
TAAAATGCCCAACATGAGTTGAGTGCTCAGAATTCTACCTTATTAATGTCTTAATATTAA
GCAAGCTAATGGTTATTCTGGGGCTAGATTTAAAAAGGGACTTCAGCCCACCCTCACTGG
ACTTTAACTTCAGAAAGAAAAAGCCTGGGAACAGAAGTTGAGAGGAATGGGAAAAAACCA
AAAAACCCCATTCCCTCTGCCATCTTGCCCCCATCATAACCCAAAATAGCATCCAAGTGG
GCAGAGATGGGGACTAAAGTTTAAAGCAAGCATCAAAGTTATACTTTTTAGGGTAATGGG
ATGAAATTTGAAGACACTATGTCAACCAATCCTAAACTCATGGATAACTGTGTTTGTGTT
CTTGTGAGAGTTGCGGTTTTGTTGTTTAATTTGGCCACGCTGCCCCATGGAGGAATTTAA
GATATCATTATTAGGCACAGCTTCCAGATTAAATACTATCCATCTTACGGAGTCCATGAG
ACAGACCCCTTGACCCCAAGGAAGGGACCGAGCTTCATGCATTTCACGATCGTGTACATA
CCTTGATAACG
Restriction Sites NotI-NotI     
ACCN NM_000161
Insert Size 3000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000161.2, NP_000152.1
RefSeq Size 2941 bp
RefSeq ORF 753 bp
Locus ID 2643
UniProt ID P30793
Cytogenetics 14q22.2
Domains GTP_cyclohydroI
Protein Families Druggable Genome
Protein Pathways Folate biosynthesis, Metabolic pathways
Gene Summary This gene encodes a member of the GTP cyclohydrolase family. The encoded protein is the first and rate-limiting enzyme in tetrahydrobiopterin (BH4) biosynthesis, catalyzing the conversion of GTP into 7,8-dihydroneopterin triphosphate. BH4 is an essential cofactor required by aromatic amino acid hydroxylases as well as nitric oxide synthases. Mutations in this gene are associated with malignant hyperphenylalaninemia and dopa-responsive dystonia. Several alternatively spliced transcript variants encoding different isoforms have been described; however, not all variants give rise to a functional enzyme. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1), also known as Type I, represents the longest transcript. Variants 1 and 2 encode the longest isoform (1), which is the active enzyme.

Other Versions

Frequently bought together (4)
GCH1 mouse monoclonal antibody,clone OTI5A1
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.