c Kit(KIT) (NM_000222) Human Untagged Clone

CAT#: SC120061

KIT (untagged)-Human v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name c Kit(KIT) (NM_000222) Human Untagged Clone
Symbol KIT
Synonyms C-Kit; CD117; PBT; SCFR
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_000222 edited
ATGAGAGGCGCTCGCGGCGCCTGGGATTTTCTCTGCGTTCTGCTCCTACTGCTTCGCGTC
CAGACAGGCTCTTCTCAACCATCTGTGAGTCCAGGGGAACCGTCTCCACCATCCATCCAT
CCAGGAAAATCAGACTTAATAGTCCGCGTGGGCGACGAGATTAGGCTGTTATGCACTGAT
CCGGGCTTTGTCAAATGGACTTTTGAGATCCTGGATGAAACGAATGAGAATAAGCAGAAT
GAATGGATCACGGAAAAGGCAGAAGCCACCAACACCGGCAAATACACGTGCACCAACAAA
CACGGCTTAAGCAATTCCATTTATGTGTTTGTTAGAGATCCTGCCAAGCTTTTCCTTGTT
GACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGAC
CCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCCTCTTCCCAAGGACTTG
AGGTTTATTCCTGACCCCAAGGCGGGCATCATGATCAAAAGTGTGAAACGCGCCTACCAT
CGGCTCTGTCTGCATTGTTCTGTGGACCAGGAGGGCAAGTCAGTGCTGTCGGAAAAATTC
ATCCTGAAAGTGAGGCCAGCCTTCAAAGCTGTGCCTGTTGTGTCTGTGTCCAAAGCAAGC
TATCTTCTTAGGGAAGGGGAAGAATTCACAGTGACGTGCACAATAAAAGATGTGTCTAGT
TCTGTGTACTCAACGTGGAAAAGAGAAAACAGTCAGCAGACTAAACTACAGGAGAAATAT
AATAGCTGGCATCACGGTGACTTCAATTATGAACGTCAGGCAACGTTGACTATCAGTTCA
GCGAGAGTTAATGATTCTGGAGTGTTCATGTGTTATGCCAATAATACTTTTGGATCAGCA
AATGTCACAACAACCTTGGAAGTAGTAGATAAAGGATTCATTAATATCTTCCCCATGATA
AACACTACAGTATTTGTAAACGATGGAGAAAATGTAGATTTGATTGTTGAATATGAAGCA
TTCCCCAAACCTGAACACCAGCAGTGGATCTATATGAACAGAACCTTCACTGATAAATGG
GAAGATTATCCCAAGTCTGAGAATGAAAGTAATATCAGATACGTAAGTGAACTTCATCTA
ACGAGATTAAAAGGCACCGAAGGAGGCACTTACACATTCCTAGTGTCCAATTCTGACGTC
AATGCTGCCATAGCATTTAATGTTTATGTGAATACAAAACCAGAAATCCTGACTTACGAC
AGGCTCGTGAATGGCATGCTCCAATGTGTGGCAGCAGGATTCCCAGAGCCCACAATAGAT
TGGTATTTTTGTCCAGGAACTGAGCAGAGATGCTCTGCTTCTGTACTGCCAGTGGATGTG
CAGACACTAAACTCATCTGGGCCACCGTTTGGAAAGCTAGTGGTTCAGAGTTCTATAGAT
TCTAGTGCATTCAAGCACAATGGCACGGTTGAATGTAAGGCTTACAACGATGTGGGCAAG
ACTTCTGCCTATTTTAACTTTGCATTTAAAGGTAACAACAAAGAGCAAATCCATCCCCAC
ACCCTGTTCACTCCTTTGCTGATTGGTTTCGTAATCGTAGCTGGCATGATGTGCATTATT
GTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTT
GTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGAT
CACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCT
TTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACT
GTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCT
GAACTCAAAGTCCTGAGTTACCTTGGTAATCACATGAATATTGTGAATCTACTTGGAGCC
TGCACCATTGGAGGGCCCACCCTGGTCATTACAGAATATTGTTGCTATGGTGATCTTTTG
AATTTTTTGAGAAGAAAACGTGATTCATTTATTTGTTCAAAGCAGGAAGATCATGCAGAA
GCTGCACTTTATAAGAATCTTCTGCATTCAAAGGAGTCTTCCTGCAGCGATAGTACTAAT
GAGTACATGGACATGAAACCTGGAGTTTCTTATGTTGTCCCAACCAAGGCCGACAAAAGG
AGATCTGTGAGAATAGGCTCATACATAGAAAGAGATGTGACTCCCGCCATCATGGAGGAT
GACGAGTTGGCCCTAGACTTAGAAGACTTGCTGAGCTTTTCTTACCAGGTGGCAAAGGGC
ATGGCTTTCCTCGCCTCCAAGAATTGTATTCACAGAGACTTGGCAGCCAGAAATATCCTC
CTTACTCATGGTCGGATCACAAAGATTTGTGATTTTGGTCTAGCCAGAGACATCAAGAAT
GATTCTAATTATGTGGTTAAAGGAAACGCTCGACTACCTGTGAAGTGGATGGCACCTGAA
AGCATTTTCAACTGTGTATACACGTTTGAAAGTGACGTCTGGTCCTATGGGATTTTTCTT
TGGGAGCTGTTCTCTTTAGGAAGCAGCCCCTATCCTGGAATGCCGGTCGATTCTAAGTTC
TACAAGATGATCAAGGAAGGCTTCCGGATGCTCAGCCCTGAACACGCACCTGCTGAAATG
TATGACATAATGAAGACTTGCTGGGATGCAGATCCCCTAAAAAGACCAACATTCAAGCAA
ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGCACCAATCATATTTACTCCAACTTA
GCAAACTGCAGCCCCAACCGACAGAAGCCCGTGGTAGACCATTCTGTGCGGATCAATTCT
GTCGGCAGCACCGCTTCCTCCTCCCAGCCTCTGCTTGTGCACGACGATGTCTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000222 unedited
GGGTCAGCATTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGCACGAGGGTGGACCA
GAGCTCGGATCCCATCGCAGCTACCGCGATGAGAGGCGCTCGCGGCGCCTGGGATTTTCT
CTGCGTTCTGCTCCTACTGCTTCGCGTCCAGACAGGCTCTTCTCAACCATCTGTGAGTCC
AGGGGAACCGTCTCCACCATCCATCCATCCAGGAAAATCAGACTTAATAGTCCGCGTGGG
CGACGAGATTAGGCTGTTATGCACTGATCCGGGCTTTGTCAAATGGACTTTTGAGATCCT
GGATGAAACGAATGAGAATAAGCAGAATGAATGGATCACGGAAAAGGCAGAAGCCACCAA
CACCGGCAAATACACGTGCACCAACAAACACGGCTTAAGCAATTCCATTTATGTGTTTGT
TAGAGATCCTGCCAAGCTTTTCCTTGTTGACCGCTCCTTGTATGGGAAAGAAGACAACGA
CACGCTGGTCCGCTGTCCTCTCACAGACCCAGAAGTGACCAATTATTCCCTCAAGGGGTG
CCAGGGGAAGCCTCTTCCCAAGGACTTGAGGTTTATTCCTGACCCCAAGGCGGGCATCAT
GATCAAAAGTGTGAAACGCGCCTACCATCGGCTCTGTCTGCATTGTTCTGTGGACCAGGA
GGGCAAGTCAGTGCTGTCGGAAAAATTCATCCTGAAAGTGAGGCCAGCCTTCAAAGCTGT
GCCTGTTGTGTCTGTGTCCAAAGCAAGCTATCTTCTTANGGAAGGGGAAAGATTCACAGT
GACGTGCACAATAAAGATGTGTCTAGNTCTGTGTACTCAAACGTGAANNAGAGANACAGT
CAGCAGACTAAACTACAGGAGAAAATATATAGCTGGCATCACGGTGACTTCATNATGAAC
GTCAGGC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000222 unedited
CTTATGGAACGCGGCACGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTATATATGTA
CATTTTATTAGAATTCTTCAGAACTGTCAACAATTGGACAACATACAGGAATAAAACACG
TGGAACACCAACATCCTTTAAACTTACGCCGCTTATGTATTTACACATAAAGTTACTGTA
TATATAAAAAATATTTTCAAGGACTCATGGGCTTGGGAATATTCAAAAGACATTATTGCT
ACATTTCAATATTTACAAAAAAAGCCACAAAATAATTTCAAACATTAAGCCACTGCAAAG
AAACATCTGATGTAAGAAAAAATTATAAAAATATAAACTTTCAAGAATATCCAAGACAAA
ACTCTCAATGAAGTGCCCCTGAAGTACCTAGACATCTATAACTAACAACCACTTTTCTTA
CTATCATTGAAGTCAATAGAAACACAAAGGAATTTTTCAGACAAAGTATGGCAAACAACA
ATCTCTTGGGTGACAACACAACCCCAAAATCTGTTAACTTTGGAAAGGTGCGAGAGCATA
GAACTCCAGTGCAAATGGTTACTTCCAGATAACGGCCACAGTTCTCTAAATGTAGTCTAA
GAAATGTAGAAGGGGGAAACCATAAAGGCAACATACCTGAATCTTTCAAGACACACACAA
ACTCTGCCATGTACACATTTGCCTTTTATATTGNGCAGTGAGGAAGGGGAGTTTTTGTTT
TGCTCTGCTTTGTTTTAAAGAGTAAACCTACCAGATTATATTCAGGCTACAGTCCTAAGG
GTAAAATTTAAAAGTTTCACGAAACAGTACCATTTATGGAAGTCCTAAGAACAGGTTCAG
TCAGATGAGTCTAAATAACAACATGCCCTAAATGCAAGTGAACTGCAAATCCTAGGGACT
GATGCTCTCCCTTCCTCTGACCCATATGGAGTCTCTCGTAAGCTCTCTCAACGCTTTGTG
AAAGAAACAAACACTCCTCAATGAAAGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000222
ORF Size 2931 bp
Insert Size 5450
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000222.1, NP_000213
RefSeq Size 5084
RefSeq ORF 2931
Locus ID 3815
Cytogenetics 4q12
Domains pkinase, TyrKc, S_TKc, ig, IGc2, IG
Protein Families Protein Kinase, ES Cell Differentiation/IPS, Transmembrane, Stem cell - Pluripotency, Adult stem cells, Embryonic stem cells, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Endocytosis, Hematopoietic cell lineage, Melanogenesis, Pathways in cancer, Acute myeloid leukemia
Gene Summary This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations