Glucocorticoid Receptor(NR3C1) (NM_000176) Human Untagged Clone

CAT#: SC120032

NR3C1 (untagged)-Human nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) (NR3C1), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Glucocorticoid Receptor(NR3C1) (NM_000176) Human Untagged Clone
Symbol NR3C1
Synonyms GCCR; GCR; GCRST; GR; GRL
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000176 edited
TCACTATAGGGCGGCCGCGAATTCGGCACGAGGAGATGATGCGGTGGTGGGGGACCTGCC
GGCACGCGACTCCCCCCGGGCCCAAATTGATATTCACTGATGGACTCCAAAGAATCATTA
ACTCCTGGTAGAGAAGAAAACCCCAGCAGTGTGCTTGCTCAGGAGAGGGGAGATGTGATG
GACTTCTATAAAACCCTAAGAGGAGGAGCTACTGTGAAGGTTTCTGCGTCTTCACCCTCA
CTGGCTGTCGCTTCTCAATCAGACTCCAAGCAGCGAAGACTTTTGGTTGATTTTCCAAAA
GGCTCAGTAAGCAATGCGCAGCAGCCAGATCTGTCCAAAGCAGTTTCACTCTCAATGGGA
CTGTATATGGGAGAGACAGAAACAAAAGTGATGGGAAATGACCTGGGATTCCCACAGCAG
GGCCAAATCAGCCTTTCCTCGGGGGAAACAGACTTAAAGCTTTTGGAAGAAAGCATTGCA
AACCTCAATAGGTCGACCAGTGTTCCAGAGAACCCCAAGAGTTCAGCATCCACTGCTGTG
TCTGCTGCCCCCACAGAGAAGGAGTTTCCAAAAACTCACTCTGATGTATCTTCAGAACAG
CAACATTTGAAGGGCCAGACTGGCACCAACGGTGGCAATGTGAAATTGTATACCACAGAC
CAAAGCACCTTTGACATTTTGCAGGATTTGGAGTTTTCTTCTGGGTCCCCAGGTAAAGAG
ACGAATGAGAGTCCTTGGAGATCAGACCTGTTGATAGATGAAAACTGTTTGCTTTCTCCT
CTGGCGGGAGAAGACGATTCATTCCTTTTGGAAGGAAACTCGAATGAGGACTGCAAGCCT
CTCATTTTACCGGACACTAAACCCAAAATTAAGGATAATGGAGATCTGGTTTTGTCAAGC
CCCAGTAATGTAACACTGCCCCAAGTGAAAACAGAAAAAGAAGATTTCATCGAACTCTGC
ACCCCTGGGGTAATTAAGCAAGAGAAACTGGGCACAGTTTACTGTCAGGCAAGCTTTCCT
GGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTACCTCT
GGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAG
AAGCCTATTCTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGC
CAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACA
GTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCC
AGCTCCTCAACAGCAACAACAGGACCACCTCCCAAACTCTGCCTGGTGTGCTCTGATGAA
GCTTCAGGATGTCATTATGGAGTCTTAACTTGTGGAAGCTGTAAAGTTTTCTTCAAAAGA
GCAGTGGAAGGACAGCACAATTACCTATGTGCTGGAAGGAATGATTGCATCATCGATAAA
ATTCGAAGAAAAAACTGCCCAGCATGCCGCTATCGAAAATGTCTTCAGGCTGGAATGAAC
CTGGAAGCTCGAAAAACAAAGAAAAAAATAAAAGGAATTCAGCAGGCCACTACAGGAGTC
TCACAAGAAACCTCTGAAAATCCTGGTAACAAAACAATAGTTCCTGCAACGTTACCACAA
CTCACCCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACCTGAAGTGTTATATGCAGGA
TATGATAGCTCTGTTCCAGACTCAACTTGGAGGATCATGACTACGCTCAACATGTTAGGA
GGGCGGCAAGTGATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTA
CACCTGGATGACCAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCT
CTGGGGTGGAGATCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTG
ATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTG
TATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGTATCTCTGTATGAAA
ACCTTACTGCTTCTCTCTTCAGTTCCTAAGGACGGTCTGAAGAGCCAAGAGCTATTTGAT
GAAATTAGAATGACCTACATCAAAGAGCTAGGAAAAGCCATTGTCAAGAGGGAAGGAAAC
TCCAGCCAGAACTGGCAGCGGTTTTATCAACTGACAAAACTCTTGGATTCTATGCATGAA
GTGGTTGAAAATCTCCTTAACTATTGCTTCCAAACATTTTTGGATAAGACCATGAGTATT
GAATTCCCCGAGATGTTAGCTGAAATCATCACCAATCAGATACCAAAATATTCAAACGGA
AATATCAAAAAACTTCTGTTTCATCAAAAGTGACTGCCTTAATAAGAATGGTTGCCTTAA
AGAAAGTCGAATTAATAGCTTTTATTGTATAAACTATCAGTTTGTCCTGTAGAGGTTTTG
TTGTTTTATTTTT
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000176 unedited
TTTTNNGTGTCAGATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGAGA
TGATGCGGTGGTGGGGGACCTGCCGGCACGCGACTCCCCCCGGGCCCAAATTGATATTCA
CTGATGGACTCCAAAGAATCATTAACTCCTGGTAGAGAAGAAAACCCCAGCAGTGTGCTT
GCTCAGGAGAGGGGAGATGTGATGGACTTCTATAAAACCCTAAGAGGAGGAGCTACTGTG
AAGGTTTCTGCGTCTTCACCCTCACTGGCTGTCGCTTCTCAATCAGACTCCAAGCAGCGA
AGACTTTTGGTTGATTTTCCAAAAGGCTCAGTAAGCAATGCGCAGCAGCCAGATCTGTCC
AAAGCAGTTTCACTCTCAATGGGACTGTATATGGGAGAGACAGAAACAAAAGTGATGGGA
AATGACCTGGGATTCCCACAGCAGGGCCAAATCAGCCTTTCCTCGGGGGAAACAGACTTA
AAGCTTTTGGAAGAAAGCATTGCAAACCTCAATAGGTCGACCAGTGTTCCAGAGAACCCC
AAGAGTTCAGCATCCACTGCTGTGTCTGCTGCCCCCACAGAGAAGGAGTTTCCAAAAACT
CACTCTGATGTATCTTCAGAACAGCAACATTTGAAGGGCCAGACTGGCACCAACGGTGGC
AATGTGAAATTGTATACCACAGACCAAAGCACCTTTGACATTNTGCAGGATTTGGAGTTT
TCTTCTGGGTCCCCAGNTAAAGAGACGAATGAGAGTNCTTGGAGATCAGACCTGTTGATA
GATGAAAACTGNTTGCTTTCTCCTCTGGCGGNAGAAGACGATTCATTCCTTTNTGNNANG
AANNNCTCGATGAGACCTGCAGCCTCTCATTTTTACCGGACACTAACCCAAATTTAGGAT
AATGGAGATCTGGNTTTGTAA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000176 unedited
CCGCATCTAGATCGAGTTTTTTTTTTTTTTTTTTCGACAAGATACTGGAGATTTGAGTCA
ATTTTTGTGGTCTTCTGATAGCTAAGTGCCATCAGGTTAAAAGCACCAACCCATTTTCAC
ACAGATGATTGATTAATGTTTAGAGTTTATTTGGGAAAGCTACGAACTAGCTGCCCATCT
TAAACAGCTGTACAATAACTTGAATAAAAAATTATGTAAGAAAAAATGAGCAAGCGTAGT
TCACTAAATATAAAGGAAATTGTTAAAACCAGACAGTAATAGCTATAAAAGGCACAACTT
CCCTTTTCTGATATACACTTGTAAACTTTTTTTCAGGTTTCCATGCATAAATCAAAAATG
CTATCCTAACTATACAGGGGGGGGATACACCAACAGAAAGTCTAGAAAATTTCATCCAGC
CAACTGTGAAAAAAAGTATGAAGAGAAAGTTCATCACACAGACTTTGGGCACTGGTGGTT
TAGGTGCCATCCTTCTTTGACTGTGGAGATTACGTCCACATATTAAGGTTTCTAATTTCT
GGGATATATTAACTAATAAATTTCACCATCTACTCTCCCATTCACTGAAAAGTGATGACG
ACTCAACTGCTTCTGTTGCCAAGTCTTGGCCCTCTATAAACCACATGTAGTGCGTATTTT
AAAACAAACACCAGATGATAACAATTAAAAATATACCACAATACCTCTACAGCACAAACT
GATAGTTTATACAATAAAAGCTATTAATTCGACTTTTCTTTAGGGCACCCATTCTTATTA
TGGCAGTCACCTTTTGATGAAACAGAAGTTTTTTGATTTTTCCGGTTGATATTTTGGTTC
TGATCGAGGATGATTCAACAACATCTCGGGAATTAATACTCATGTCTTTCCAAATAGTTG
GAAGCATATTAAGGAAATTTCAACCCCTCATGCTAAAACAAAAATTTGCCAGTGATAACC
CCTGCACCTCTGGCGAGTTCCTCCCTTTGAATGGCTTCCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000176
ORF Size 2334 bp
Insert Size 3700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000176.2, NP_000167
RefSeq Size 6784
RefSeq ORF 2334
Locus ID 2908
Cytogenetics 5q31.3
Domains HOLI, GCR, zf-C4
Protein Families Nuclear Hormone Receptor, Transcription Factors, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes glucocorticoid receptor, which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011].
Transcript Variant: This variant (1) represents the predominant transcript, and encodes the predominant physiological isoform (alpha, also known as GRalpha or GR-A). Variants 1-5 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations