PDHA1 (NM_000284) Human Untagged Clone

CAT#: SC119981

PDHA1 (untagged)-Human pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), nuclear gene encoding mitochondrial protein, transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PDHA1 (NM_000284) Human Untagged Clone
Symbol PDHA1
Synonyms PDHA; PDHAD; PDHCE1A; PHE1A
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119981 sequence for NM_000284 edited (data generated by NextGen Sequencing)
ATGAGGAAGATGCTCGCCGCCGTCTCCCGCGTGCTGTCTGGCGCTTCTCAGAAGCCGGCA
AGCAGAGTGCTGGTAGCATCCCGTAATTTTGCAAATGATGCTACATTTGAAATTAAGAAA
TGTGACCTTCACCGGCTGGAAGAAGGCCCTCCTGTCACAACAGTGCTCACCAGGGAGGAT
GGGCTCAAATACTACAGGATGATGCAGACTGTACGCCGAATGGAGTTGAAAGCAGATCAG
CTGTATAAACAGAAAATTATTCGTGGTTTCTGTCACTTGTGTGATGGTCAGGAAGCTTGC
TGTGTGGGCCTGGAGGCCGGCATCAACCCCACAGACCATCTCATCACAGCCTACCGGGCT
CACGGCTTTACTTTCACCCGGGGCCTTTCCGTCCGAGAAATTCTCGCAGAGCTTACAGGA
CGAAAAGGAGGTTGTGCTAAAGGGAAAGGAGGATCGATGCACATGTATGCCAAGAACTTC
TACGGGGGCAATGGCATCGTGGGAGCGCAGGTGCCCCTGGGCGCTGGGATTGCTCTAGCC
TGTAAGTATAATGGAAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAAC
CAGGGCCAGATATTCGAAGCTTACAACATGGCAGCTTTGTGGAAATTACCTTGTATTTTC
ATCTGTGAGAATAATCGCTATGGAATGGGAACGTCTGTTGAGAGAGCGGCAGCCAGCACT
GATTACTACAAGAGAGGCGATTTCATTCCTGGGCTGAGAGTGGATGGAATGGATATCCTG
TGCGTCCGAGAGGCAACAAGGTTTGCTGCTGCCTATTGTAGATCTGGGAAGGGGCCCATC
CTGATGGAGCTGCAGACTTACCGTTACCACGGACACAGTATGAGTGACCCTGGAGTCAGT
TACCGTACACGAGAAGAAATTCAGGAAGTAAGAAGTAAGAGTGACCCTATTATGCTTCTC
AAGGACAGGATGGTGAACAGCAATCTTGCCAGTGTGGAAGAACTAAAGGAAATTGATGTG
GAAGTGAGGAAGGAGATTGAGGATGCTGCCCAGTTTGCCACGGCCGATCCTGAGCCACCT
TTGGAAGAGCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCGTGGTGCC
AATCAGTGGATCAAGTTTAAGTCAGTCAGTTAA

Clone variation with respect to NM_000284.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000284 unedited
GGGCACCATTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGCACGAGGGTCTGCTGG
GGCACCTGAAGGAGACTTGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCC
GCTGCCGCCACTGCCTGTGCTTCATGAGGAAGATGCTCGCCGCCGTCTCCCGCGTGCTGT
CTGGCGCTTCTCAGAAGCCGGCAAGCAGAGTGCTGGTAGCATCCCGTAATTTTGCAAATG
ATGCTACATTTGAAATTAAGAAATGTGACCTTCACCGGCTGGAAGAAGGCCCTCCTGTCA
CAACAGTGCTCACCAGGGAGGATGGGCTCAAATACTACAGGATGATGCAGACTGTACGCC
GAATGGAGTTGAAAGCAGATCAGCTGTATAAACAGAAAATTATTCGTGGTTTCTGTCACT
TGTGTGATGGTCAGGAAGCTTGCTGTGTGGGCCTGGAGGCCGGCATCAACCCCACAGACC
ATCTCATCACAGCCTACCGGGCTCACGGCTTTACTTTCACCCGGGGCCTTTCCGTCCGAG
AAATTCTCGCAGAGCTTACAGGACGAAAAGGAGGTTGTGCTAAAGGGAAAGGAGGATCGA
TGCACATGTATGCCAAGAACTTCTACGGNGGCAATGGCATCGTGGGAGCGCAGGTGCCCC
TGNGCGCTGGGATTGCTCTAGCCCTGTAGTATAATGGAAAAGATGAGGTCTGCCTGACTN
TATATGGCGATGGTGCTGCTAACCAGNGCCAGATATTCGAAGCTTACAACATGGCAGCCT
TTGTGGAAATTACCTTGTATTNTCATCTGTGAGAATAATCGCTATGGAATGGGAACGTCT
GTTGAGAGAGCGGCAGCCAGCACTGATTACTANCAGAGAGGGCGATTCATTCCTGGGCTG
AGAGTGGATGGAATGGATATCCTGT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000284 unedited
TTGGACCGCGGCCGCTTCTATAGTCGGTTTTTTTTTTTTTTTTTTAATCTTTAAGCACTC
AATAATTCATCTTTTAATGCACTAATGTACAAACTGCATGCAATTACTACCTGCTCAATC
TACACACTTAATGGAAGTTTCCAAGAATTTCATTGAATTTCATTGACTGGGTTTTCTTCC
TCCTTAACCAAGTTGAGAACACTGTCTGGTAGCCCCCTGAAGGTATAACCTCTCCTTCTC
CTCCCCTTAACTGACTGACTTAAACTTGATCCACTGATTGGCACCACGAACTTCAAAAGG
TGGGTCGCTGGAGTAGATGTGGTAGCCCAGCTCTTCCAAAGGTGGCTCAGGATCGGCCGT
GGCAAACTGGGCAGCATCCTCAATCTCCTTCCTCACTTCCACATCAATTTCCTTTAGTTC
TTCCACACTGGCAAGATTGCTGTTCACCATCCTGTCCTTGAGAAGCATAATAAGGTCACT
CTTACTTCTTACTTCCTGAATTTCTTCTCGTGTACGGTAACTGACTCCAGGGTCACTCAT
ACTGTGTCCGTGGGAACGGTAAGTCTGCAACTCCATAAGAATGGCCCCTTTTCCCAATTT
ACATTGGGCGCCAGCAAACCTTTGTTGCCCTTTGGGCCCCCAAGGAATCCTTTCCTTCCC
CTTTAAACCCAAAAAGAAAAACCCCTCCTTTGTGGAAAAAAAGGGGGGGGGGGCGCTTTT
TTAAAAAAAATGTCCCCTTCTTATAAGATTTTTTTCCCCAATAAAAAAAAAGGGGGTTTT
CCCCCAACGCCCCGCCGGGGGAGGCCTAAAATTTTGGGCCGGGGTGGAACCCCCCCCCCC
TCTTTTTTAATGAGGGGGACCATTTTTTTTTTTTTTTTTTTTTGGGCGGAGAGAAAAANC
CCCCCGGGGGGGGGGGCGGTCTCTCCAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000284
ORF Size 1173 bp
Insert Size 1460
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000284.1, NP_000275
RefSeq Size 1472
Locus ID 5160
Cytogenetics Xp22.12
Domains E1_dehydrog
Protein Families Druggable Genome
Protein Pathways Glycolysis / Gluconeogenesis, Citrate cycle (TCA cycle), Valine, leucine and isoleucine biosynthesis, Pyruvate metabolism, Butanoate metabolism, Metabolic pathways
Gene Summary The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
Transcript Variant: This variant (1) represents the predominant transcript and encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations