Calcium Sensing Receptor(CASR) (NM_000388) Human Untagged Clone

CAT#: SC119946

CASR (untagged)-Human calcium-sensing receptor (CASR), transcript variant 2

USD 1,041.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Calcium Sensing Receptor(CASR) (NM_000388) Human Untagged Clone
Symbol CASR
Synonyms CAR; EIG8; FHH; FIH; GPRC2A; HHC; HHC1; HYPOC1; NSHPT; PCAR1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119946 sequence for NM_000388 edited (data generated by NextGen Sequencing)
ATGGCATTTTATAGCTGCTGCTGGGTCCTCTTGGCACTCACCTGGCACACCTCTGCCTAC
GGGCCAGACCAGCGAGCCCAAAAGAAGGGGGACATTATCCTTGGGGGGCTCTTTCCTATT
CATTTTGGAGTAGCAGCTAAAGATCAAGATCTCAAATCAAGGCCGGAGTCTGTGGAATGT
ATCAGGTATAATTTCCGTGGGTTTCGCTGGTTACAGGCTATGATATTTGCCATAGAGGAG
ATAAACAGCAGCCCAGCCCTTCTTCCCAACTTGACGCTGGGATACAGGATATTTGACACT
TGCAACACCGTTTCTAAGGCCTTGGAAGCCACCCTGAGTTTTGTTGCTCAAAACAAAATT
GATTCTTTGAACCTTGATGAGTTCTGCAACTGCTCAGAGCACATTCCCTCTACGATTGCT
GTGGTGGGAGCAACTGGCTCAGGCGTCTCCACGGCAGTGGCAAATCTGCTGGGGCTCTTC
TACATTCCCCAGGTCAGTTATGCCTCCTCCAGCAGACTCCTCAGCAACAAGAATCAATTC
AAGTCTTTCCTCCGAACCATCCCCAATGATGAGCACCAGGCCACTGCCATGGCAGACATC
ATCGAGTATTTCCGCTGGAACTGGGTGGGCACAATTGCAGCTGATGACGACTATGGGCGG
CCGGGGATTGAGAAATTCCGAGAGGAAGCTGAGGAAAGGGATATCTGCATCGACTTCAGT
GAACTCATCTCCCAGTACTCTGATGAGGAAGAGATCCAGCATGTGGTAGAGGTGATTCAA
AATTCCACGGCCAAAGTCATCGTGGTTTTCTCCAGTGGCCCAGATCTTGAGCCCCTCATC
AAGGAGATTGTCCGGCGCAATATCACGGGCAAGATCTGGCTGGCCAGCGAGGCCTGGGCC
AGCTCCTCCCTGATCGCCATGCCTCAGTACTTCCACGTGGTTGGCGGCACCATTGGATTC
GCTCTGAAGGCTGGGCAGATCCCAGGCTTCCGGGAATTCCTGAAGAAGGTCCATCCCAGG
AAGTCTGTCCACAATGGTTTTGCCAAGGAGTTTTGGGAAGAAACATTTAACTGCCACCTC
CAAGAAGGTGCAAAAGGACCTTTACCTGTGGACACCTTTCTGAGAGGTCACGAAGAAAGT
GGCGACAGGTTTAGCAACAGCTCGACAGCCTTCCGACCCCTCTGTACAGGGGATGAGAAC
ATCAGCAGTGTCGAGACCCCTTACATAGATTACACGCATTTACGGATATCCTACAATGTG
TACTTAGCAGTCTACTCCATTGCCCACGCCTTGCAAGATATATATACCTGCTTACCTGGG
AGAGGGCTCTTCACCAATGGCTCCTGTGCAGACATCAAGAAAGTTGAGGCGTGGCAGGTC
CTGAAGCACCTACGGCATCTAAACTTTACAAACAATATGGGGGAGCAGGTGACCTTTGAT
GAGTGTGGTGACCTGGTGGGGAACTATTCCATCATCAACTGGCACCTCTCCCCAGAGGAT
GGCTCCATCGTGTTTAAGGAAGTCGGGTATTACAACGTCTATGCCAAGAAGGGAGAAAGA
CTCTTCATCAACGAGGAGAAAATCCTGTGGAGTGGGTTCTCCAGGGAGGTGCCCTTCTCC
AACTGCAGCCGAGACTGCCTGGCAGGGACCAGGAAAGGGATCATTGAGGGGGAGCCCACC
TGCTGCTTTGAGTGTGTGGAGTGTCCTGATGGGGAGTATAGTGATGAGACAGATGCCAGT
GCCTGTAACAAGTGCCCAGATGACTTCTGGTCCAATGAGAACCACACCTCCTGCATTGCC
AAGGAGATCGAGTTTCTGTCGTGGACGGAGCCCTTTGGGATCGCACTCACCCTCTTTGCC
GTGCTGGGCATTTTCCTGACAGCCTTTGTGCTGGGTGTGTTTATCAAGTTCCGCAACACA
CCCATTGTCAAGGCCACCAACCGAGAGCTCTCCTACCTCCTCCTCTTCTCCCTGCTCTGC
TGCTTCTCCAGCTCCCTGTTCTTCATCGGGGAGCCCCAGGACTGGACGTGCCGCCTGCGC
CAGCCGGCCTTTGGCATCAGCTTCGTGCTCTGCATCTCATGCATCCTGGTGAAAACCAAC
CGTGTCCTCCTGGTGTTTGAGGCCAAGATCCCCACCAGCTTCCACCGCAAGTGGTGGGGG
CTCAACCTGCAGTTCCTGCTGGTTTTCCTCTGCACCTTCATGCAGATTGTCATCTGTGTG
ATCTGGCTCTACACCGCGCCCCCCTCAAGCTACCGCAACCAGGAGCTGGAGGATGAGATC
ATCTTCATCACGTGCCACGAGGGCTCCCTCATGGCCCTGGGCTTCCTGATCGGCTACACC
TGCCTGCTGGCTGCCATCTGCTTCTTCTTTGCCTTCAAGTCCCGGAAGCTGCCGGAGAAC
TTCAATGAAGCCAAGTTCATCACCTTCAGCATGCTCATCTTCTTCATCGTCTGGATCTCC
TTCATTCCAGCCTATGCCAGCACCTATGGCAAGTTTGTCTCTGCCGTAGAGGTGATTGCC
ATCCTGGCAGCCAGCTTTGGCTTGCTGGCGTGCATCTTCTTCAACAAGATCTACATCATT
CTCTTCAAGCCATCCCGCAACACCATCGAGGAGGTGCGTTGCAGCACCGCAGCTCACGCT
TTCAAGGTGGCTGCCCGGGCCACGCTGCGCCGCAGCAACGTCTCCCGCAAGCGGTCCAGC
AGCCTTGGAGGCTCCACGGGATCCACCCCCTCCTCCTCCATCAGCAGCAAGAGCAACAGC
GAAGACCCATTCCCACAGCCCGAGAGGCAGAAGCAGCAGCAGCCGCTGGCCCTAACCCAG
CAAGAGCAGCAGCAGCAGCCCCTGACCCTCCCACAGCAGCAACGATCTCAGCAGCAGCCC
AGATGCAAGCAGAAGGTCATCTTTGGCAGCGGCACGGTCACCTTCTCACTGAGCTTTGAT
GAGCCTCAGAAGAACGCCATGGCCCACAGGAATTCTACGCACCAGAACTCCCTGGAGGCC
CAGAAAAGCAGCGATACGCTGACCCGACACCAGCCATTACTCCCGCTGCAGTGCGGGGAA
ACGGACTTAGATCTGACCGTCCAGGAAACAGGTCTGCAAGGACCTGTGGGTGGAGACCAG
CGGCCAGAGGTGGAGGACCCTGAAGAGTTGTCCCCAGCACTTGTAGTGTCCAGTTCACAG
AGCTTTGTCATCAGTGGTGGAGGCAGCACTGTTACAGAAAACGTAGTGAATTCATAA

Clone variation with respect to NM_000388.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000388 unedited
CCATTCAGATTTGTATACGATTCATATAGGCGGCCTGCGAATTCGCACCAGCTTTCGCGC
TAGAGAGTGGAAGGAGGGAGCTGTTTGCCAGCACCGAGGTCTTGCGGCACAGGCAACGCT
TGACCTGAGTCTTGCAGAATGAAAGGCATCACAGGAGGCCTCTGCATGATGTGGCTTCCA
AAGACTCAAGGACCACCCACATTACAAGTCTGGATTGAGGAAGGCAGAAATGGAGATTCA
AACACCACGTCTTCTATTATTTTATTAATCAATCTGTAGACATGTGTCCCCACTGCAGGG
AGTGAACTGCTCCAAGGGAGAAACTTCTGGGAGCCTCCAAACTCCTAGCTGTCTCATCCC
TTGCCCTGGAGAGACGGCAGAACCATGGCATTTTATAGCTGCTGCTGGGTCCTCTTGGCA
CTCACCTGGCACACCTCTGCCTACGGGCCAGACCAGCGAGCCCAAAAGAAGGGGGACATT
ATCCTTGGGGGGCTCTTTCCTATTCATTTTGGAGTAGCAGCTAAAGATCAAGATCTCAAA
TCAAGGCCGGAGTCTGTGGAATGTATCAGGTATAATTTCCGTGGGTTTCGCTGGTTACAG
GCTATGATATTTGCCATAGAGGAGATAAACAGCAGCCCAGCCCTTCTTCCACACTTGACG
CTGGGATACAGGATATTTGACACTTGCAACACCGTTTCTAAGGCCTTGGAAGCCACCCTG
AGTTTTGTTGCTCAGAACAAAATTGATTCTTTGAACCTTGATGAGTTCTGCAACTGCTCA
GAGCACATTCCCTCTACGATTGCTGTGGTGGGAGCAACTGGCTCAGGCGTCTCCCGGCAG
TGGCACTCTGCTGGNGCTCTTCTACATCCCCNAGTCAGACTTGCTNCTNCAGCAGATNCT
CAGCACTAGATT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000388 unedited
AAATACGTTGAACCGCGGCCCGCTATCTACGAGCGNGGNATTTTTTTTTTTTTTTTTTGC
TCTTCTTTTTTTTTAATTTTAAAGGGAACATGGGTCAATTCACTGTCATTTAAGATGGTG
TGACTAAATTCGGGGCATTTGATGTGTCTATTATCCCTTCTTCCTCAGAGGAAAGGAGTC
TGGGGCGATTCCTCATCCCTGGGACCCCAAGAAACCTCTCTGCATTCTCCCTAGCCCAGG
CTTCTCCTTCCATTTTATGAATTCACTACGTTTTCTGTAACAGTGCTGCCTCCACCACTG
ATGACAAAGCTCTGTGAACTGGACACTACAAGTGCTGGGGACAACTCTTCAGGGTCCTCC
ACCTCTGGCCGCTGGTCTCCACCCACAGGTCCTTGCAGACCTGTTTCCTGGACGGTCAGA
TCTAAGTCCGTTTCCCCGCACTGCAGCGGGAGTAATGGCTGGTGTCGGGTCAGCGTATCG
CTGCTTTTCTGGGCCTCCAGGGAGTTCTGGTGCGTAAAATTCCTGTGGGCCATGGCGTTC
TTCTGAGGCTCATCAAAGCTCAGTGAGAAGGTGACCGTGCCGCTGCCAAAGATGACCTTC
TGCTTGCATCTGGGCTGCTGCTGAGATCGTTGCTGCTGTGGGAGGGTCAGGGGCTGCTGC
TGCTGCTCTTGCTGGGATAGGGCCAACGGCTGCTGCTGCTTCTGCCTCTCGGGCTGTGGG
AATGGGTCTTCGCTGTTGCTCTTGCTGCTGATGGAGGAGAGGGGGGTTGGATCCTCGTGG
AGCCTCCTAGGCTGCTGNACCGCTTGCTGGAAGACGTTGCTGCNGCGCCACCGTGCCCTG
GCAGCCACTTTAAAGCGTGAGCTGCGGTGCTGCACGCACTCCCCCAGGTGTTTCCGGAAT
GGCTTAAAAGAGGAAGTNCATTTGTTGAAAAAC
Tag Tag Free
ACCN NM_000388
ORF Size 3237 bp
Insert Size 3500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000388.2, NP_000379
RefSeq Size 4913
Locus ID 846
Cytogenetics 3q13.33-q21.1
Protein Families GPCR, Transmembrane, Druggable Genome
Gene Summary Senses changes in the extracellular concentration of calcium ions. The activity of this receptor is mediated by a G-protein that activates a phosphatidylinositol-calcium second messenger system. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has an alternate 5' UTR exon and lacks an in-frame segment in the CDS, as compared to variant 1. The resulting isoform (2) is shorter and lacks an internal segment, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations