HFE (NM_000410) Human Untagged Clone

CAT#: SC119914

HFE (untagged)-Human hemochromatosis (HFE), transcript variant 1

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HFE (NM_000410) Human Untagged Clone
Symbol HFE
Synonyms HFE1; HH; HLA-H; MVCD7; TFQTL2
Vector pCMV6-XL5
Sequence Data
>OriGene ORF within SC119914 sequence for NM_000410 edited (data generated by NextGen Sequencing)
ATGGGCCCGCGAGCCAGGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTG
CAGGGGCGCTTGCTGCGTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAG
GACCTTGGTCTTTCCTTGTTTGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTC
TATGATCATGAGAGTCGCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCA
AGCCAGATGTGGCTGCAGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTT
GACTTCTGGACTATTATGGAAAATCACAACCACAGCAAGGAGTCCCACACCCTGCAGGTC
ATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACTGAGGGCTACTGGAAGTACGGGTAT
GATGGGCAGGACCACCTTGAATTCTGCCCTGACACACTGGATTGGAGAGCAGCAGAACCC
AGGGCCTGGCCCACCAAGCTGGAGTGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGG
GCCTACCTGGAGAGGGACTGCCCTGCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGAGGT
GTTTTGGACCAACAAGTGCCTCCTTTGGTGAAGGTGACACATCATGTGACCTCTTCAGTG
ACCACTCTACGGTGTCGGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGCTG
AAGGATAAGCAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGG
GATGGGACCTACCAGGGCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATAT
ACGTGCCAGGTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATCTGGGAGCCCTCA
CCGTCTGGCACCCTAGTCATTGGAGTCATCAGTGGAATTGCTGTTTTTGTCGTCATCTTG
TTCATTGGAATTTTGTTCATAATATTAAGGAAGAGGCAGGGTTCAAGAGGAGCCATGGGG
CACTACGTCTTAGCTGAACGTGAGTGA

Clone variation with respect to NM_000410.3
396 c=>t
>OriGene 5' read for NM_000410 unedited
TGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGCCCCCCAAAAGAA
GCGGAGATTTAACGGGGACGTGCGGCCAGAGCTGGGGAAATGGGCCCGCGAGCCAGGCCG
GCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTGCAGGGGCGCTTGCTGCGTTCA
CACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCTTGTTT
GAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTCGCCGT
GTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATGTGGCTGCAGCTG
AGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGGACTATTATGGAA
AATCACAACCACAGCAAGGAGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAA
GAAGACAACAGTACTGAGGGCTACTGGAAGTACGGGTATGATGGGCAGGACCACCTTGAA
TTCTGCCCTGACACACTGGATTGGAGAGCAGCAGAACCCAGGGCCTGGCCCACCAAGCTG
GAGTGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTGC
CCTGCACAGCTGCANCAGTTGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAGTGCCTC
CTTTGGTGAAGTGACACATCATGTGACCTCTTCAGTGACCACTCTACGGTGTCGGNCCTT
GAACTACTANCCCCAGACATCACCATGAAGTGGCTGAAGGATAGCAGCCATGGATGCCAN
GNAGNTCGAACCTAAGACGTATTGCCCATGGNGGATGGGACCTACCANGGCTGGATACCN
TNGNCTGTANCCCCTGNAGNAGAGCANANAATACGC
>OriGene 3' read for NM_000410 unedited
AACGCGGCCACTATCTAGAGTCGAGNTCTTTTTTTTTTTTTTTTTTTACTTTTTTTTTTT
GAAAAGGAGTCTCACTTTGTTACCTTAAGCTGGTATTGCATTGTTTTCAAACTTTTTTTT
ACTGTTATCTTTGTCTTTTGGGTTCATGCCTTTTTTCTGCCTTATTCTTTCTATTACTTG
GGACTACAGGCGTCCGTCACCACGCCCATTTAATTTTTTGTATTTTTACTAAAAATGGGG
TTTCACCATGTTACCCATGATGGTCTCGATCTCCTGACCTCGCGATCCACCCGCTTTGGC
CTCCCAAAGCGCTGGGATTACAGGCGTGAGCCAACGGGCCCGGCCTACTTATCTTTCTTC
ATTTAAAAAAGAAATGGGGATAATAGCACCTATCTCATAAAATTATTGTAACAAGTGCAT
GCAGTAATGCATGCAAACACGCGCCCAAAACACTCCGACACCAACTAACTGCCCTTATCA
TCCTTATCATAATTCCCATTTTCAAAACAAGGAGAGACCAGGTAGAAAATTATTGGGATT
CTTCAGGGCCGGAATACCAAAGTAGCATTCCAAATGAAAGCACCATTAAACTTCTGCAAT
CCGTATGACACCCTTCATGCCAATAGAAAATACCACTTTTACAACCCCTTTAAAAATTTC
CCTCCTACCCCGCTAAAACCCCATCTTCCTCCCACAGATATCCCGAAGCTTCTTTTGGAC
AAGTGCCTTTTTATTTCCGCAGCGCCAGGCTTATTCATGGGAACCGACATTAAATCACAA
GGAATAACCCCCAAGCTTTGTGACAAATGAGCCCCGGGAACACAAGAAAAGGGTTCACAG
GAAAATTTAACGCGCCCCAAAATCGCTCAACCCCGGCGAAAATCCCGTAAGGTTAAACTC
ACCCCTTCCCAGGGGAAAAATNTTCTTAAAGTGAAAAGAATCCGGAACCCCCAAATAAGG
GATCCCTTCCAAAAGGAAAGAAACCCATAGGCACTTTTCAGCGCCGGAAAAGAGN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000410
ORF Size 1047 bp
Insert Size 2820
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000410.2, NP_000401
RefSeq Size 2727
RefSeq ORF 1047
Locus ID 3077
Cytogenetics 6p22.2
Domains MHC_I, ig, IGc1
Protein Families Transmembrane, Druggable Genome
Gene Summary The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) encodes the longest isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.