Ornithine Carbamoyltransferase(OTC) (NM_000531) Human Untagged Clone

CAT#: SC119821

OTC (untagged)-Human ornithine carbamoyltransferase (OTC), nuclear gene encoding mitochondrial protein

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ornithine Carbamoyltransferase(OTC) (NM_000531) Human Untagged Clone
Symbol OTC
Synonyms OCTD
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119821 sequence for NM_000531 edited (data generated by NextGen Sequencing)
ATGCTGTTTAATCTGAGGATCCTGTTAAACAATGCAGCTTTTAGAAATGGTCACAACTTC
ATGGTTCGAAATTTTCGGTGTGGACAACCACTACAAAATAAAGTGCAGCTGAAGGGCCGT
GACCTTCTCACTCTAAAAAACTTTACCGGAGAAGAAATTAAATATATGCTATGGCTATCA
GCAGATCTGAAATTTAGGATAAAACAGAAAGGAGAGTATTTGCCTTTATTGCAAGGGAAG
TCCTTAGGCATGATTTTTGAGAAAAGAAGTACTCGAACAAGATTGTCTACAGAAACAGGC
TTTGCACTTCTGGGAGGACATCCTTGTTTTCTTACCACACAAGATATTCATTTGGGTGTG
AATGAAAGTCTCACGGACACGGCCCGTGTATTGTCTAGCATGGCAGATGCAGTATTGGCT
CGAGTGTATAAACAATCAGATTTGGACACCCTGGCTAAAGAAGCATCCATCCCAATTATC
AATGGGCTGTCAGATTTGTACCATCCTATCCAGATCCTGGCTGATTACCTCACGCTCCAG
GAACACTATAGCTCTCTGAAAGGTCTTACCCTCAGCTGGATCGGGGATGGGAACAATATC
CTGCACTCCATCATGATGAGCGCAGCGAAATTCGGAATGCACCTTCAGGCAGCTACTCCA
AAGGGTTATGAGCCGGATGCTAGTGTAACCAAGTTGGCAGAGCAGTATGCCAAAGAGAAT
GGTACCAAGCTGTTGCTGACAAATGATCCATTGGAAGCAGCGCATGGAGGCAATGTATTA
ATTACAGACACTTGGATAAGCATGGGACAAGAAGAGGAGAAGAAAAAGCGGCTCCAGGCT
TTCCAAGGTTACCAGGTTACAATGAAGACTGCTAAAGTTGCTGCCTCTGACTGGACATTT
TTACACTGCTTGCCCAGAAAGCCAGAAGAAGTGGATGATGAAGTCTTTTATTCTCCTCGA
TCACTAGTGTTCCCAGAGGCAGAAAACAGAAAGTGGACAATCATGGCTGTCATGGTGTCC
CTGCTGACAGATTACTCACCTCAGCTCCAGAAGCCTAAATTTTGA

Clone variation with respect to NM_000531.5
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000531 unedited
NAAGTTCACATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGGGACTTT
GATAAGGAAGCTGAAGGGTGATATTACCTTTGCTCCCTCACTGCAACTGAACACATTTCT
TAGTTTTTAGGTGGCCCCCGCTGGCTAACTTGCTGTGGAGTTTTCAAGGGCATAGAATCG
TCCTTTACACAATTAAAAGAAGATGCTGTTTAATCTGAGGATCCTGTTAAACAATGCAGC
TTTTAGAAATGGTCACAACTTCATGGTTCGAAATTTTCGGTGTGGACAACCACTACAAAA
TAAAGTGCAGCTGAAGGGCCGTGACCTTCTCACTCTAAAAAACTTTACCGGAGAAGAAAT
TAAATATATGCTATGGCTATCAGCAGATCTGAAATTTAGGATAAAACAGAAAGGAGAGTA
TTTGCCTTTATTGCAAGGGAAGTCCTTAGGCATGATTTTTGAGAAAAGAAGTACTCGAAC
AAGATTGTCTACAGAAACAGGCTTTGCACTTCTGGGAGGACATCCTTGTTTTCTTACCAC
ACAAGATATTCATTTGGGTGTGAATGAAAGTCTCACGGACACGGCCCGTGTATTGTCTAG
CATGGCAGATGCAGTATTGGCTCGAGTGTATAAACAATCAGATTTGGACACCCTGGCTAA
AGAAGCATCCATCCCAATTATCAATGGGCTGTCAGATTTGTACCATCCTATCCAGATCCT
GGCTGATTACCTCACGCTCCAGGAACACTATAGCTCTCTGAAAGGTCTTACCCTCAGCTG
GATCGGGGATGGGAACAATATCCTGCACTCCATCATGATGAGCGCAGCGAAATTTCGAAT
GCACCTTNCAGCAGCTACTCCAAAGGGTTATGAGCCGATGCTAGTGTAACCAAGTTGGGC
AGGCAGTATGCCAAAGAGAATGC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000531 unedited
NTTACTCTGNNACCGCGGCCGCATNCTANGATCGAGTTTTTTTTTTTTTTTTTTTTTAGG
TGACAGGATTTATTATGTACACCAAAGATGCAAGCGTCATTTCTAGAATTTTCGTTAAAC
TTCGGAGTTGTAATAGCTATATAGGAAAAGGGGTAAGAAGAAAGAGGAGATGAAAACAGC
TTTGCAAAAGTTAAGGGTGAATTTTCCTCCCCTATTTTCTTTTTTCCTGACAATATAAAT
AATGTCTGATTAAGATGAAAAGTTAAGAAAGCAAATACATTCCTACAGAATTGGGCTGAG
AATGAGGTTAAATTGTATGTACACAATAAAGAAAGCTATAGAGCTTTTTGAGGAAAAAAT
GACTATATTTTGGCAAGAAAATTATTACAAGTTCTTTCCAAGTGAGGGAAGAAGACTATA
CCATCCATTTAGTTCAAAGAATAACCAGGAATGAGATGGGAGCTCGTTACTATGGCAGAC
CATTTGGCAAGTGGAAGAACACTTCTTTCTATGTAGGCAATTTGAGGGTGAGCCTTCCAC
AATCCATATGACACCTTGTTCTACTCTCTGCTGAAAGATATTCCACTAAACTCCACTCTC
TTTCTAAGTGCTTCCAATAAATTACTATGGACACAAAAGTCACCTTTGACATTTACTGGA
AAATTTGATGTTTTTTTCTGTAACATTATGAGCCTCTTTCCCCCACAAAAAATGTTTTAT
TGCACCTTCATTGCAAATCTAATTTGTAATTCATCCCTTGCTTACTCATTTAAGTCAGAG
CTGTGTGCTGAAGAATATCAGTCAACCAGCCTGGAAACATTNTTCTAATAGTAAATGTAG
AATGGTAAGGAAATACATTATTNTGTCTTCTGTAAATGTATAATTTTTAAAAAACTTCAC
TATGTTATTTACATTNNTACTANNAATCAATATTCATATATTCACATACAATG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000531
ORF Size 1065 bp
Insert Size 2800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000531.3, NP_000522
RefSeq Size 1927
RefSeq ORF 1065
Locus ID 5009
Cytogenetics Xp11.4
Domains OTCace, OTCace_N
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Metabolic pathways
Gene Summary This nuclear gene encodes a mitochondrial matrix enzyme. Missense, nonsense, and frameshift mutations in this enzyme lead to ornithine transcarbamylase deficiency, which causes hyperammonemia. Since the gene for this enzyme maps close to that for Duchenne muscular dystrophy, it may play a role in that disease also. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.