Adenosine A2b Receptor(ADORA2B) (NM_000676) Human Untagged Clone

CAT#: SC119758

ADORA2B (untagged)-Human adenosine A2b receptor (ADORA2B)

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Adenosine A2b Receptor(ADORA2B) (NM_000676) Human Untagged Clone
Symbol ADORA2B
Synonyms ADORA2; ADORA2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000676 edited
GGAGGCGCGGTCCGGGCGCTATGGCCATGCCCGGCGGGTCTCACGCGGCTGCCCCTCGCC
CGGCGCGCCTTCGGTAGGGGGCGCCCGGGGCCCAGCTGGCCCGGCCATGCTGCTGGAGAC
ACAGGACGCGCTGTACGTGGCGCTGGAGCTGGTCATCGCCGCGCTTTCGGTGGCGGGCAA
CGTGCTGGTGTGCGCCGCGGTGGGCACGGCGAACACTCTGCAGACGCCCACCAACTACTT
CCTGGTGTCCCTGGCTGCGGCCGACGTGGCCGTGGGGCTCTTCGCCATCCCCTTTGCCAT
CACCATCAGCCTGGGCTTCTGCACTGACTTCTACGGCTGCCTCTTCCTCGCCTGCTTCGT
GCTGGTGCTCACGCAGAGCTCCATCTTCAGCCTTCTGGCCGTGGCAGTCGACAGATACCT
GGCCATCTGTGTCCCGCTCAGGTATAAAAGTTTGGTCACGGGGACCCGAGCAAGAGGGGT
CATTGCTGTCCTCTGGGTCCTTGCCTTTGGCATCGGATTGACTCCATTCCTGGGGTGGAA
CAGTAAAGACAGTGCCACCAACAACTGCACAGAACCCTGGGATGGAACCACGAATGAAAG
CTGCTGCCTTGTGAAGTGTCTCTTTGAGAATGTGGTCCCCATGAGCTACATGGTATATTT
CAATTTCTTTGGGTGTGTTCTGCCCCCACTGCTTATAATGCTGGTGATCTACATTAAGAT
CTTCCTGGTGGCCTGCAGGCAGCTTCAGCGCACTGAGCTGATGGACCACTCGAGGACCAC
CCTCCAGCGGGAGATCCATGCAGCCAAGTCACTGGCCATGATTGTGGGGATTTTTGCCCT
GTGCTGGTTACCTGTGCATGCTGTTAACTGTGTCACTCTTTTCCAGCCAGCTCAGGGTAA
AAATAAGCCCAAGTGGGCAATGAATATGGCCATTCTTCTGTCACATGCCAATTCAGTTGT
CAATCCCATTGTCTATGCTTACCGGAACCGAGACTTCCGCTACACTTTTCACAAAATTAT
CTCCAGGTATCTTCTCTGCCAAGCAGATGTCAAGAGTGGGAATGGTCAGGCTGGGGTACA
GCCTGCTCTCGGTGTGGGCCTATGATCTAGGCTCTCGCCTCTTCCAGGAGAAGATACAAA
TCCACAAGAAACAAAGAGGACACGGCTGGTTTTCATTGTGAAAGATAGCTACACCTCACA
AGGAAATGGACTGCCTCTCTTGAGCACTTCCCTGGAGCTACCACGTATCTAGCTAATATG
TATGTGTCAGTAGTAGGCTCCAAGGATTGACAAATATATTTATGATCTATTCAGCTGCTT
TTACTGTGTGGATTATGCCAACAGCTTGAATGGATTCTAACAGACTCTTTTGTTTTTAAA
AGTCTGCCTTGTTTATGGTGGAAAATTACTGAAACTATTTTACTGTGAAACAGTGTGAAC
TATTATAATGCAAATACTTTTTAACTTAGAGGCAATGGAAAAATAAAAGTTGACTGTACT
AAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000676 unedited
GTCAAATTTGTATACGACTCACTATAGGCGGCCGACGAATTCGCACCAGGAGCGCGGTCC
GGGCGCTATGGCCATGCCCGGCGGGTCTCACGCGGCTGCCCCTCGCCCGGCGCGCCTTCG
GTAGGGGGCGCCCGGGGCCCATCTGGCCCGGCCATGCTGCTGGAGACACAGGACGCGCTG
TACGTGGCGCTGGAGCTGGTCATCGCCGCGCTTTCGGTGGCGGGCAACGTGCTGGTGTGC
GCCGCGGTGGGCACGGCGAACACTCTGCAGACGCCCACCAACTACTTCCTGGTGTCCCTG
GCTGCGGCCGACGTGGCCGTGGGGCTCTTCGCCATCCCCTTTGCCATCACCATCAGCCTG
GGCTTCTGCACTGACTTCTACGGCTGCCTCTTCCTCGCCTGCTTCGTGCTGGTGCTCACG
CAGAGCTCCATCTTCAGCCTTCTGGCCGTGGCAGTCGACAGATACCTGGCCATCTGTGTC
CCGCTCATGTATAAAAGTTTGGTCACGGGGACCCGAGCAAGATGGGTCATTGCTGTCCTC
TGGGTCCTTGCCTTTGGCATCGGATTGACTCCATTCCTGGGGTGGAACAGTAAAGACAGT
GCCACCAACAACTGCACAGAACCCTGGGATGGAACCACGAATGATAGCTGCTGCCTTGAG
AAGAGTCTCTCTGAGAATGTGGTCCCCATGAGCTACATGGTATATCTCAATTTCTTTGGG
TGTGTTCTGCCCCCACTGCTTATAATGCTGGCGATCTACATTAAGATCTTCCTGGTGGCC
TGCCAGCAGCTTCAGCGCACTGAGCTGATGGACCACTCGATGACCACCCTCCAGCGGGAG
ATCCATGCAGCCCAGTCACTGCCCATGATTGTGGAGGATTTTTGCCCTGTGCTGGTTACC
TGTGCATGCTGTTAACTGTGTCACTCTTTTTCCGNCCGCTCAGGGTTAAATAACCCCAGG
GGCAATGATAATGGCTTNCTTCGTCCATGCCATT
Tag Tag Free
ACCN NM_000676
ORF Size 999 bp
Insert Size 1500
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000676.2, NP_000667
RefSeq Size 1885
RefSeq ORF 999
Locus ID 136
Cytogenetics 17p12
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Vascular smooth muscle contraction
Gene Summary This gene encodes an adenosine receptor that is a member of the G protein-coupled receptor superfamily. This integral membrane protein stimulates adenylate cyclase activity in the presence of adenosine. This protein also interacts with netrin-1, which is involved in axon elongation. The gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.