Annexin A1 (ANXA1) (NM_000700) Human Untagged Clone

CAT#: SC119713

ANXA1 (untagged)-Human annexin A1 (ANXA1)


  "NM_000700" in other vectors (6)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Anti-ANXA1 (Annexin A1) mouse monoclonal antibody, clone OTI3A8 (formerly 3A8)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Annexin A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Annexin A1
Synonyms ANX1; LPC1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_000700 edited
GAATTCGGCACGAGGCTATGCACAAGGCCGTGCATTTAAAAATAAACTCCCTAAGGCTGG
GGTGAAACCTGCTACGGTCTGCGCAAGTTGACTGTTAATGAATTTGATTCTCAGGTACAC
TTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGA
AGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAG
CCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGT
TAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCG
TCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAA
GAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCA
ATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCT
AATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAG
AGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCG
GAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGA
CTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGA
CGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTT
TCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAA
AGGTGACATTGAGAAATGCCTCACAGCTATCGTGAAGTGCGCCACAAGCAAACCAGCTTT
CTTTGCAGAGAAGCTTCATCAAGCCATGAAAGGTGTTGGAACTCGCCATAAGGCATTGAT
CAGGATTATGGTTTCCCGTTCTGAAATTGACATGAATGATATCAAAGCATTCTATCAGAA
GATGTATGGTATCTCCCTTTGCCAAGCCATCCTGGATGAAACCAAAGGAGATTATGAGAA
AATCCTGGTGGCTCTTTGTGGAGGAAACTAAACATTCCCTTGATGGTCTCAAGCTATGAT
CAGAAGACTTTAATTATATATTTTCATCCTATAAGCTTAAATAGGAAAGTTTCTTCAACA
GGATTACAGTGTAGCTACCTACATGCTGAAAAATATAGCCTTTAAATCATTTTTATATTA
TAACTCTGTATAATAGAGATAAGTCCATTTTTTAAAAATGTTTTCCCCAAACCATAAAAC
CCTATACAAGTTGTTCTAGTAACAATACATGAGAAAGATGTCTATGTAGCTGAAAATAAA
ATGACGTCACAAGACAAAAAAAAAAAAAAAAAACTCGAC
>OriGene 5' read for NM_000700 unedited
NGGTCAACTTTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGCACGAGGCTATGCAC
AAGGCCGTGCATTTAAAATAAACTCCCTAAGCTGGGGTGAAACCTGCTACGGTCTGCGCA
AGTTGACTGTTAATGAATTTGATTCTCAGGTACACTTTTTCAAAAATGGCAATGGTATCA
GAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTG
AAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCC
TCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATC
ATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTC
CAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAG
GAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCT
GCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACT
AACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCC
AAAGACATAACCTCAGACACATCTGGAGATTNTCGGAACGCTTTGCTTTCTCTTGCTAAG
GGTGACCGATCTGAGGACTTNTGTGTGAATGAAGACTTGGCTGATTCAGATGCCCAGGCC
CTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGNTCAATACCATNCCT
TACACCAGNAGCTATCCACAACTTCGCAAAGTGTTTCAGAATACACCAAGTACAGNTAGC
ATN
>OriGene 3' read for NM_000700 unedited
CGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGTCTTGAGACGTCATTTTATTTTCA
GCTACATAGACATCTTTCTCATGTATTGGTACTAAAACAACTTGTATAGGGTTTTATGGT
TTGGGGAAAACATTTTTAAAAAATGGACTTATCTCTATTATACAGAGTTATAATATAAAA
ATGATTTAAAGGCTATATTTTTCAGCATGTAAGTAGCTACACTGTAATCCTGTTGAAGAA
ACTTTCCTATTTAAGCTTATAGGATGAAAATATATAATTAAAGTCTTCTGATCATAGCTT
GAGACCATCAAGGGAATGTTTAGTTTCCTCCACAAAGAGCCACCAGGATTTTCTCATAAT
CTCCTTTGGTTTCATCCAGGATGGCCTTGGCAAAGGGAGATACCATACATCTTCTGATAG
AATGCTTTGATATCATTCATGTCAATTTCAGAACGGGAAACCATAATCCTGATCAATGCC
TTATGGCGAGTTCCAACACCTTTCATGGCTTGATGAAGCTTCTCTGCAAAGAAAACTGGT
TTGCTTGTGGCGCACTTCACGATAGCTGTGAGGCATTTCTCAATGTCACCTTTTAACTTC
AGGTCCAGAACTTTGTTCATGTCATGCCTTACTGTACTTGGAGTATTTCTGAAAACTCTG
CGAAATTGCGGATATCTTCTGGGGGTAAAGATGGTCTCTGAACCCCTTTACCGTTGGTCC
CTTTTTTCCTTCTCCTGCCTAATACAGGCCCTGGATTTGAATAAACCAATTCTTATTTAC
ACCAAATCCTCTAAATAGTTCCCCCTATCATAAAAAAACAAACCTCCCGAAAATCCCCCC
ATGGGCTTGAGGTTATTGTCTTGGACAAATCCTTCTCACCTCCCTCTCGGAAACCCCTGA
AAGCCCCCGAACCCCTGCGGNACCTTGACCCCAAACTCATTAAAATTCTTTCTCTCTCCA
GGCCCTTCTCGGTACCAAATTTTCCCCTATATTCCCGCCCT
Restriction Sites NotI-NotI     
ACCN NM_000700
Insert Size 1610 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000700.1, NP_000691.1
RefSeq Size 1399 bp
RefSeq ORF 1041 bp
Locus ID 301
UniProt ID P04083
Cytogenetics 9q21.13
Domains annexin
Protein Families Druggable Genome
Gene Summary This gene encodes a membrane-localized protein that binds phospholipids. This protein inhibits phospholipase A2 and has anti-inflammatory activity. Loss of function or expression of this gene has been detected in multiple tumors. [provided by RefSeq, Dec 2014]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.