IL1 Receptor I(IL1R1) (NM_000877) Human Untagged Clone

CAT#: SC119624

IL1R1 (untagged)-Human interleukin 1 receptor, type I (IL1R1)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name IL1 Receptor I(IL1R1) (NM_000877) Human Untagged Clone
Symbol IL1R1
Synonyms CD121A; D2S1473; IL-1R-alpha; IL1R; IL1RA; P80
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000877 edited
GAATTCGGCACGAGTCTCGCCCCTCTGAGCTGAGCCGGGTTCCGCCCGGGGCTGGGATCC
CATCACCCTCCACGGCCGTCCGTCCAGGTAGACGCACCCTCTGAAGATGGTGACTCCCTC
CTGAGAAGCTGGACCCCTTGGTAAAAGACAAGGCCTTCTCCAAGAAGAATATGAAAGTGT
TACTCAGACTTATTTGTTTCATAGCTCTACTGATTTCTTCTCTGGAGGCTGATAAATGCA
AGGAACGTGAAGAAAAAATAATTTTAGTGTCATCTGCAAATGAAATTGATGTTCGTCCCT
GTCCTCTTAACCCAAATGAACACAAAGGCACTATAACTTGGTATAAAGATGACAGCAAGA
CACCTGTATCTACAGAACAAGCCTCCAGGATTCATCAACACAAAGAGAAACTTTGGTTTG
TTCCTGCTAAGGTGGAGGATTCAGGACATTACTATTGCGTGGTAAGAAATTCATCTTACT
GCCTCAGAATTAAAATAAGTGCAAAATTTGTGGAGAATGAGCCTAACTTATGTTATAATG
CACAAGCCATATTTAAGCAGAAACTACCCGTTGCAGGAGACGGAGGACTTGTGTGCCCTT
ATATGGAGTTTTTTAAAAATGAAAATAATGAGTTACCTAAATTACAGTGGTATAAGGATT
GCAAACCTCTACTTCTTGACAATATACACTTTAGTGGAGTCAAAGATAGGCTCATCGTGA
TGAATGTGGCTGAAAAGCATAGAGGGAACTATACTTGTCATGCATCCTACACATACTTGG
GCAAGCAATATCCTATTACCCGGGTAATAGAATTTATTACTCTAGAGGAAAACAAACCCA
CAAGGCCTGTGATTGTGAGCCCAGCTAATGAGACAATGGAAGTAGACTTGGGATCCCAGA
TACAATTGATCTGTAATGTCACCGGCCAGTTGAGTGACATTGCTTACTGGAAGTGGAATG
GGTCAGTAATTGATGAAGATGACCCAGTGCTAGGGGAAGACTATTACAGTGTGGAAAATC
CTGCAAACAAAAGAAGGAGTACCCTCATCACAGTGCTTAATATATCGGAAATTGAAAGTA
GATTTTATAAACATCCTTTTACCTGTTTTGCCAAGAATACACATGGTATAGATGCAGCAT
ATATCCAGTTAATATATCCAGTCACTAATTTCCAGAAGCACATGATTGGTATATGTGTCA
CGTTGACAGTCATAATTGTGTGTTCTGTTTTCATCTATAAAATCTTCAAGATTGACATTG
TGCTTTGGTACAGGGATTCCTGCTATGATTTTCTCCCAATAAAAGCTTCAGATGGAAAGA
CCTATGACGCATATATACTGTATCCAAAGACTGTTGGGGAAGGGTCTACCTCTGACTGTG
ATATTTTTGTGTTTAAAGTCTTGCCTGAGGTCTTGGAAAAACAGTGTGGATATAAGCTGT
TCATTTATGGAAGGGATGACTACGTTGGGGAAGACATTGTTGAGGTCATTAATGAAAACG
TAAAGAAAAGCAGAAGACTGATTATCATTTTAGTCAGAGAAACATCAGGCTTCAGCTGGC
TGGGTGGTTCATCTGAAGAGCAAATAGCCATGTATAATGCTCTTGTTCAGGATGGAATTA
AAGTTGTCCTGCTTGAGCTGGAGAAAATCCAAGACTATGAGAAAATGCCAGAATCGATTA
AATTCATTAAGCAGAAACATGGGGCTATCCGCTGGTCAGGGGACTTTACACAGGGACCAC
AGTCTGCAAAGACAAGGTTCTGGAAGAATGTCAGGTACCACATGCCAGTCCAGCGACGGT
CACCTTCATCTAAACACCAGTTACTGTCACCAGCCACTAAGGAGAAACTGCAAAGAGAGG
CTCACGTGCCTCTCGGGTAGCATGGAGAAGTTGCCAAGAGTTCTTTAGGTGCCTCCTGTC
TTATGGCGTTGCAGGCCAGGTTATGCCTCATGCTGACTTGCAGAGTTCATGGAATGTAAC
TATATCATCCTTTATCCCTGAGGTCACCTGGAATCAGATTATTAAGGGAATAAGCCATGA
CGTCAATAGCAGCCCAGGGCACTTCAGAGTAGAGGGCTTGGGAAGATCTTTTAAAAAGGC
AGTAGGCCCGGTGTGGTGGCTCACGCCTATAATCCCAGCACTTTGGGAGGCTGAAGTGGG
TGGATCACCAGAGGTCAGGAGTTCGAGACCAGCCCAGCCAACATGGCAAAACCCCATCTC
TACTAAAAATACAAAAATGAGCTAGGCATGGTGGCACACGCCTGTAATCCCAGCTACACC
TGAGGCTGAGGCAGGAGAATTGCTTGAACCGGGGAGACGGAGGTTGCAGTGAGCCGAGTT
TGGGCCACTGCACTCTAGCCTGGCAACAGAGCAAGACTCCGTCTCAAAAAAAGGGCAATA
AATGCCCTCTCTGAATGTTTGAACTGCCAAGAAAAGGCATGGAGACAGCGAACTAGAAGA
AAGGGCAAGAAGGAAATAGCCACCGTCTACAGATGGCTTAGTTAAGTCATCCACAGCCCA
AGGGCGGGGCTATGCCTTGTCTGGGGACCCTGTAGAGTCACTGACCCTGGAGCGGCTCTC
CTGAGAGGTGCTGCAGGCAAAGTGAGACTGACACCTCACTGAGGAAGGGAGACATATTCT
TGGAGAACTTTCCATCTGCTTGTATTTTCCATACACATCCCCAGCCAGAAGTTAGTGTCC
GAAGACCGAATTTTATTTTACAGAGCTTGAAAACTCACTTCAATGAACAAAGGGATTCTC
CAGGATTCCAAAGTTTTGAAGTCATCTTAGCTTTCCACAGGAGGGAGAGAACTTAAAAAA
GCAACAGTAGCAGGGAATTGATCCACTTCTTAATGCTTTCCTCCCTGGCATGACCATCCT
GTCCTTTGTTATTATCCTGCATTTTACGTCTTTGGAGGAACAGCTCCCTAGTGGCTTCCT
CCATCTGCAATGTCCCTTGCACAGCCCACACATGAACCATCCTTCCCATGATGCCGCTCT
TCTGTCATCCCGCTCCTGCTGAAACACCTCCCAGGGGCTCCACCTGTTCAGGAGCTGAAG
CCCATGCTTTCCCACCAGCATGTCACTCCCAGACCACCTCCCTGCCCTGTCCTCCAGCTT
CCCCTCGCTGTCCTGCTGTGTGAATTCCCAGGTTGGCCTGGTGGCCATGTCGCCTGCCCT
CAGCACTCCTCTGTCTCTGCTCTTGCCTGCACCCTTCCTCCTCCTTTGCCTAGGAGGCCT
TCTCGCATTTTCTCTAGCTGATCAGAATTTTACCAAAATTCAGAACATCCTCCAATTCCA
CAGTCTCTGGGAGACTTTCCCTAAGAGGCGACTTCCTCTCCAGCCTTCTCTCTCTGGTCA
GGCCCACTGCAGAGATGGTGGTGAGCACATCTGGGAGGCTGGTCTCCCTCCAGCTGGAAT
TGCTGCTCTCTGAGGGAGAGGCTGTGGTGGCTGTCTCTGTCCCTCACTGCCTTCCAGGAG
CAATTTGCACATGTAACATAGATTTATGTAATGCTTTATGTTTAAAAACATTCCCCAATT
ATCTTATTTAATTTTTGCAATTATTCTAATTTTATATATAGAGAAAGTGACCTATTTTTT
AAAAAAATCACACTCTAAGTTCTATTGAACCTAGGACTTGAGCCTCCATTTCTGGCTTCT
AGTCTGGTGTTCTGAGTACTTGATTTCAGGTCAATAACGGTCCCCCCTCACTCCACACTG
GCACGTTTGTGAGAAGAAATGACATTTTGCTAGGAAGTGACCGAGTCTAGGAATGCTTTT
ATTCAAGACACCAAATTCCAAACTTCTAAATGTTGGAATTTTCAAAAATTGTGTTTAGAT
TTTATGAAAAACTCTTCTACTTTCATCTATTCTTTCCCTAGAGGCAAACATTTCTTAAAA
TGTTTCATTTTCATTAAAAATGAAAGCCAAATTTATATGCCACCGATTGCAGGACACAAG
CACAGTTTTAAGAGTTGTATGAACATGGAGAGGACTTTTGGTTTTTATATTTCTCGTATT
TAATATGGGTGAACACCAACTTTTATTTGGAATAATAATTTTCCTCCTAAACAAAAACAC
ATTGAGTTTAAGTCTCTGACTCTTGCCTTTCCACCTGCTTTCTCCTGGGCCCGCTTTGCC
TGCTTGAAGGAACAGTGCTGTTCTGGAGCTGCTGTTCCAACAGACAGGGCCTAGCTTTCA
TTTGACACACAGACTACAGCCAGAAGCCCATGGAGCAGGGATGTCACGTCTTGAAAAGCC
TATTAGATGTTTTACAAATTTAATTTTGCAGATTATTTTAGTCTGTCATCCAGAAAATGT
GTCAGCATGCATAGTGCTAAGAAAGCAAGCCAATTTGGAAACTTAGGTTAGTGACAAAAT
TGGCCAGAGAGTGGGGGTGATGATGACCAAGAATTACAAGTAGAATGGCAGCTGGAATTT
AAGGAGGGACAAGAATCAATGGATAAGCGTGGGTGGAGGAAGATCCAAACAGAAAAGTGC
AAAGTTATTCCCCATCTTCCAAGGGTTGAATTCTGGAGGAAGAAGACACATTCCTAGTTC
CCCGTGAACTTCCTTTGACTTATTGTCCCCACTAAAACAAAACAAAAAACTTTTAATGCC
TTCCACATTAATTAGATTTTCTTGCAGTTTTTTTATGGCATTTTTTTAAAGATGCCCTAA
GTGTTGAAGAAGAGTTTGCAAATGCAACAAAATATTTAATTACCGGTTGTTAAAACTGGT
TTAGCACAATTTATATTTTCCCTCTCTTGCCTTTCTTATTTGCAATAAAAGGTATTGAGC
CATTTTTTAAATGACATTTTTGATAAATTATGTTTGTACTAGTTGATGAAGGAGTTTTTT
TTAACCTGTTTATATAATTTTGCAGCAGAAGCCAAATTTTTTGTATATTAAAGCACCAAA
TTCATGTACAGCATGCATCACGGATCAATAGACTGTACTTATTTTCCAATAAAATTTTCA
AACTTTAAAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000877 unedited
CGCGAATTCGGCACGAGTCTCGCCCCTCTGAGCTGAGCCGGGTTCCGCCCGGGGCTGGGA
TCCCATCACCCTCCACGGCCGTCCGTCCAGGTAGACGCACCCTCTGAAGATGGTGACTCC
CTCCTGAGAAGCTGGACCCCTTGGTAAAAGACAAGGCCTTCTCCAAGAAGAATATGAAAG
TGTTACTCAGACTTATTTGTTTCATAGCTGTACTGATTTCTTCTCTGGAGGCTGATAAAT
GCAAGGAACGTGAAGAAAAAATAATTTTAGTGTCATCTGCAAATGAAATTGATGTTCGTC
CCTGTCCTCTTAACCCAAATGAACACAAAGGCACTATAACTTGGTATAAAGATGACAGCA
AGACACCTGTATCTACAGAACAAGCCTCCAGGATTCATCAACACAAAGAGAAACTTTGGT
TTGTTCCTGCTAAGGTGGAGGATTCAGGACATTACTATTGCGTGGTAAGAAATTCATCTT
ACTGCCTCAGAATTAAAATAAGTGCAAAATTTGTGGAGAATGAGCCTAACTTATGTTATA
ATGCACAAGCCATATTTAAGCAGAAACTACCCGTTGCAGGAGACGGAGGACTTGTGTGCC
CTTATATGGAGTTTTTTAAAAATGAAAATAATGAGTTACCTAAATTACAGTGGTATAAGG
ATTGCAAACCTCTACTTCTTGANCATATACACTNTAAGTGGAGTCAAAGATAGGGCTCAT
CGTGAATGAATGGTGGCTGAA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000877 unedited
TTTGGACGCGGCCGCTTTCTAAAGTCGGTTTTTTTTTTTTTTTTTTAAAGTTTGAAAATT
TTATCTGGAAAATAAGTACANGTCTATTAGATCCGTGATGCATAGCTGTACATGAAATTT
GGTAGCTTTAATATACAAAAAATTTGGCTCTCTGCTGCAAAATTATATAAACAGGTTAAA
AAAAACTCCTTCATCAACTAGTACAAACATAATTTATCAAAAATGTCATTTAAAAAATGG
CTCAATACCTTTTATTGCAAATAAGAAAGGCAAGAGAGGGAAAATATAAATTGTGCTAAA
CCAGTTTTAACAACCGGTAATTAAATATTTTGTTGCATTTGCAAACTCTTCTTCAACACT
TAGGGCATCTTTAAAAAAATGCCATAAAAAAACTGCAAGAAAATCTAATTAATGTGGAAG
GCATTAAAAGTTTTTTGTTTTGTTTTAGTGGGGACAATAAGTCAAAGGAAGTTCACGGGG
AACTAGGAATGTGTCTTCTTCCTCCAGAATTCAACCCTTGGAAGATGGGGAATAACTTTG
CACTTTTCTGTTTGGATCTTCCTCCACCCACGCTTATCCATTGATTCTTGTCCCTCCTTA
AATTCCAGCTGCCATTCTACTTGTAATTCTTGGTCATCATCACCCCCACTCTCTGGCCAA
TTTTGTCACTAACCTAAGTTTCCAAATTGGCTTGCTTTCTTAGCACTATGCATGCTGACA
CATTCTCTGGATGACAGACTAAAATAATCTGGAAAATAAATTTGGAAAACATCAAATAAG
CTTTTCAAGACGTGACATCCCTGCCCCAGGGCCTTCTGGCTGTATCCCGGGGGTCAAATG
AAACCCAGCCCTGGCCGGGGGACAGCAGCTCAGAAAACCCTGGTCCTTAAGCGGCAAAGG
GGCCCAGCAAAACCCGGGGCAAAGGCAAATCACACCTTATACCCCGGGTTTTTGTTAACA
GAAAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000877
ORF Size 1710 bp
Insert Size 4890
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000877.2, NP_000868
RefSeq Size 4909
RefSeq ORF 1710
Locus ID 3554
Cytogenetics 2q11.2-q12.1
Domains TIR, IG
Protein Families Transmembrane, Druggable Genome
Protein Pathways MAPK signaling pathway, Cytokine-cytokine receptor interaction, Apoptosis, Hematopoietic cell lineage
Gene Summary This gene encodes a cytokine receptor that belongs to the interleukin-1 receptor family. The encoded protein is a receptor for interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist. It is an important mediator involved in many cytokine-induced immune and inflammatory responses. This gene is located in a cluster of related cytokine receptor genes on chromosome 2q12. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations