Oxytocin Receptor(OXTR) (NM_000916) Human Untagged Clone

CAT#: SC119610

OXTR (untagged)-Human oxytocin receptor (OXTR)

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Oxytocin Receptor(OXTR) (NM_000916) Human Untagged Clone
Symbol OXTR
Synonyms OT-R; OT-R
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119610 sequence for NM_000916 edited (data generated by NextGen Sequencing)
ATGGAGGGCGCGCTCGCAGCCAACTGGAGCGCCGAGGCAGCCAACGCCAGCGCCGCGCCG
CCGGGGGCCGAGGGCAACCGCACCGCCGGACCCCCGCGGCGCAACGAGGCCCTGGCGCGC
GTGGAGGTGGCGGTGCTGTGTCTCATCCTGCTCCTGGCGCTGAGCGGGAATGCGTGTGTG
CTGCTGGCGCTGCGCACCACACGCCAGAAGCACTCGCGCCTCTTCTTCTTCATGAAGCAC
CTAAGCATCGCCGACCTGGTGGTGGCAGTGTTTCAGGTGCTGCCGCAGTTGCTGTGGGAC
ATCACCTTCCGCTTCTACGGGCCCGACCTGCTGTGCCGCCTGGTCAAGTACTTGCAGGTG
GTGGGCATGTTCGCCTCCACCTACCTGCTGCTGCTCATGTCCCTGGACCGCTGCCTGGCC
ATCTGCCAGCCGCTGCGCTCGCTGCGCCGCCGCACCGACCGCCTGGCAGTGCTCGCCACG
TGGCTCGGCTGCCTGGTGGCCAGCGCGCCGCAGGTGCACATCTTCTCTCTGCGCGAGGTG
GCTGACGGCGTCTTCGACTGCTGGGCCGTCTTCATCCAGCCCTGGGGACCCAAGGCCTAC
ATCACATGGATCACGCTAGCTGTCTACATCGTGCCGGTCATCGTGCTCGCTGCCTGCTAC
GGCCTTATCAGCTTCAAGATCTGGCAGAACTTGCGGCTCAAGACCGCTGCAGCGGCGGCG
GCCGAGGCGCCAGAGGGCGCGGCGGCTGGCGATGGGGGGCGCGTGGCCCTGGCGCGTGTC
AGCAGCGTCAAGCTCATCTCCAAGGCCAAGATCCGCACGGTCAAGATGACTTTCATCATC
GTGCTGGCCTTCATCGTGTGCTGGACGCCTTTCTTCTTCGTGCAGATGTGGAGCGTCTGG
GATGCCAACGCGCCCAAGGAAGCCTCGGCCTTCATCATCGTCATGCTCCTGGCCAGCCTC
AACAGCTGCTGCAACCCCTGGATCTACATGCTGTTCACGGGCCACCTCTTCCACGAACTC
GTGCAGCGCTTCCTGTGCTGCTCCGCCAGCTACCTGAAGGGCAGACGCCTGGGAGAGACG
AGTGCCAGCAAAAAGAGCAACTCGTCCTCCTTTGTCCTGAGCCATCGCAGCTCCAGCCAG
AGGAGCTGCTCCCAGCCATCCACGGCGTGA

Clone variation with respect to NM_000916.3
171 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000916 unedited
CCATTCGCATCGAGTGGAGATTCTTTCGGGGAGGTGATTTGGTTTTAGATTCCTACTCCC
GGAGGAACGTTGCTGATTTTGACCCTCCCTTCTCCCCCAGTGGAAGCCGCTGAACATCCC
GAGGAACTGGCACGCTGGGGGCTCTGGGCTTGTGGCCGGTAGAGGATTCCTGCCTANNTC
AGTGGCTTATAGGAGGGTGGACTCAGCAGATCCGTCCGTGGAGTCTCCAGGAGTGGAGCC
CCGGGCGCCCCTACACCCTCCGACACGCCGGATCCGGCCCAGCCGCGCCAAGCCGTAAAG
GGCTCGAAGGCCGGGGCGCACCGCTGCCGCCAGGGTCATGGAGGGCGCGCTCGCAGCCAA
CTGGAGCGCCGAGGCAGCCAACGCCAGCGCCGCGCCGCCGGGGGCCGAGGGCAACCGCAC
CGCCGGACCCCCGCGGCGCAACGAGGCCCTGGCGCGCGTGGAGGTGGCGGTGCTGTGTCT
CATCCTGCTCCTGGCGCTGAGCGGGAATGCGTGTGTGCTGCTGGCGCTGCGCACCACACG
CCAGAAGCACTCGCGCCTCTTCTTCTTCATGAAGCACCTAAGCATCGCCGACCTGGTGGT
GGCAGTGTTTCAAGTGCTGCCGCAGTTGCTGTGGGACATCACCTTCCGCTTCTAAGGCCC
CGACCTGCTGTGCCGCCTGGTCAAGTACTTGCAGGTGGTGGGCATGTTCGCCTCCACCTA
CCTGCTGGTGCTCATGTCCCTGGACCGCTGCCTGGCCATCTGCCAACCGCTGCGCTCGTT
GAGCCGGCGCACCGAACGCCTGGCAGTGCCTCCCCCCGTGGCTTCGCCTGGCCTGGTGGC
CCACGCGCCCGAGGTGCCCCATTTTTTTTCTGCCCG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000916 unedited
GTATGGACCGCGGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTCTGTTGAATTTTTTTTGTTTATTTTTATTTTTTAAAGTTCATTGGTTTTTAGTACATT
CTCAAAATCGTGCACAATCACCACTAATTTCAGAACATTTTCATCACCCGAAAAAAAAAC
CCCAAACCCTTAGTAGTCATGCCTCATCTCTCACAGCCTCCAGGCCCTGGCAAACGCTAA
TCTATATTCACTCTATATAGATTCGTCCATTTTAGACATTGCATTTCAATGCAGTCAGAC
AATATGTGGGCTTTTGCACCTGGCTTCTTTCACTTAGCAAGTTTTCAAGGCTCATCCATG
TTGTGGCATGTGTGAGTACTTCATTTCTTTTTAGAGTCTAATAATGTTCCATTGCGTGGA
CAGACCACATTTTATTTCCCATTCATCAGTTGGTAGACATTTGGGTTGTTTCCACTTTTT
GGCTATTACAAATAATGTTGCTATGAACATTGGTGTACAAGTTTTTGTGTGTATGTACGT
TTTCATTTCTCTTGGGTAAATACCTAGGAGTGGCATTCCTGGGTCATATGGTCACTCTAC
GTTTAACTTTTTGAGGTACTGCCAAACTGTTTTTCAAAGCAGGTGCACCATTTACATTCC
CACCAACAATTTAAATTTCTACCAGTTTCTCTACATCCTCACCGACACTCGTTCTTGTCC
ATCTTTTTATTGTAGCCATCCTAGTGATTGTAAACTGGAATCTCATTGTGATTTTGACTT
GCATTTCCCTAATGAATATAATGTTGAGTATTTTTTCATGTGGCTAGTACCATTTGCATA
TCTTCTTTGGAGAAATGCTATTCAAACCGTTAGCCCATTTTTAAATTGNATTATTTTTCT
CCTTATTGGGGGGTTAAAGAATTATTTTATATTTCCGAAACAAGCCCTTATATAATATGA
CTCCAAAATTTTTCCCTTTGCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000916
ORF Size 1170 bp
Insert Size 4500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000916.3, NP_000907
RefSeq Size 4361
Locus ID 5021
Cytogenetics 3p25.3
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary The protein encoded by this gene belongs to the G-protein coupled receptor family and acts as a receptor for oxytocin. Its activity is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. The oxytocin-oxytocin receptor system plays an important role in the uterus during parturition. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.