Kappa Opioid Receptor(OPRK1) (NM_000912) Human Untagged Clone

CAT#: SC119606

OPRK1 (untagged)-Human opioid receptor, kappa 1 (OPRK1)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Kappa Opioid Receptor(OPRK1) (NM_000912) Human Untagged Clone
Symbol OPRK1
Synonyms K-OR-1; KOR; KOR-1; OPRK
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_000912, the custom clone sequence may differ by one or more nucleotides


ATGGACTCCCCGATCCAGATCTTCCGCGGGGAGCCGGGCCCTACCTGCGCCCCGAGCGCCTGCCTGCCCC
CCAACAGCAGCGCCTGGTTTCCCGGCTGGGCCGAGCCCGACAGCAACGGCAGCGCCGGCTCGGAGGACGC
GCAGCTGGAGCCCGCGCACATCTCCCCGGCCATCCCGGTCATCATCACGGCGGTCTACTCCGTAGTGTTC
GTCGTGGGCTTGGTGGGCAACTCGCTGGTCATGTTCGTGATCATCCGATACACAAAGATGAAGACAGCAA
CCAACATTTACATATTTAACCTGGCTTTGGCAGATGCTTTAGTTACTACAACCATGCCCTTTCAGAGTAC
GGTCTACTTGATGAATTCCTGGCCTTTTGGGGATGTGCTGTGCAAGATAGTAATTTCCATTGATTACTAC
AACATGTTCACCAGCATCTTCACCTTGACCATGATGAGCGTGGACCGCTACATTGCCGTGTGCCACCCCG
TGAAGGCTTTGGACTTCCGCACACCCTTGAAGGCAAAGATCATCAATATCTGCATCTGGCTGCTGTCGTC
ATCTGTTGGCATCTCTGCAATAGTCCTTGGAGGCACCAAAGTCAGGGAAGACGTCGATGTCATTGAGTGC
TCCTTGCAGTTCCCAGATGATGACTACTCCTGGTGGGACCTCTTCATGAAGATCTGCGTCTTCATCTTTG
CCTTCGTGATCCCTGTCCTCATCATCATCGTCTGCTACACCCTGATGATCCTGCGTCTCAAGAGCGTCCG
GCTCCTTTCTGGCTCCCGAGAGAAAGATCGCAACCTGCGTAGGATCACCAGACTGGTCCTGGTGGTGGTG
GCAGTCTTCGTCGTCTGCTGGACTCCCATTCACATATTCATCCTGGTGGAGGCTCTGGGGAGCACCTCCC
ACAGCACAGCTGCTCTCTCCAGCTATTACTTCTGCATCGCCTTAGGCTATACCAACAGTAGCCTGAATCC
CATTCTCTACGCCTTTCTTGATGAAAACTTCAAGCGGTGTTTCCGGGACTTCTGCTTTCCACTGAAGATG
AGGATGGAGCGGCAGAGCACTAGCAGAGTCCGAAATACAGTTCAGGATCCTGCTTACCTGAGGGACATCG
ATGGGATGAATAAACCAGTATGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_000912 unedited
TCTTACCCGCCCGTTGNCTCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGC
AGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGA
ATTCGGCACCAGGCGGAACAGCAGCCCTCGGGCGGAGAGCGGGGCCGGGGTCCGAGAGCA
GGTGATGCCAAGAGCTGAGCGGGACTCGTGAGCGCGCGGTTCAGCACCTACCAGGGCGTC
CCGTAAAAAACCTCGCCTTCGCCTGTCTCTGGGAACCATAGCGCCGCAGGTGCCGCCTGT
CCTCGCCTTCCTGCTGCAATCGCCCCACCATGGACTCCCCGATCCAGATCTTCCGCGGGG
AGCCGGGCCCTACCTGCGCCCCGAGCGCCTGCCTGCCCCCCAACAGCAGCGCCTGGTTTC
CCGGCTGGGCCGAGCCCGACAGCAACGGCAGCGCCGGCTCGGAGGACGCGCAGCTGGAGC
CCGCGCACATCTCCCCGGCCATCCCGGTCATCATCACGGCGGTCTACTCCGTAGTGTTCG
TCGTGGGCTTGGTGGGCAACTCGCTGGTCATGTTCGTGATCATCCGATACACAAAGATGA
AGACAGCAACCAACATTTACATATTTAACCTGGCTTTGGCAGATGCTTTAGTTACTACAA
CCATGCNCTTTCAGAGTACGGTCTACTTGATGAATTCCTGGCCTTTTGGGGATGTGCTGT
GCAAGATAGTAATTTCCATTGATTACTANCACATGTTCACCAGCATCTTCACCTTGACCA
TGATGAGCGTGGACCGCTACATTGCCGTGTGCCACCCCGTGAAAGGCTTGGNACTCCGCA
CACCCTTGAAGGCAAAGATCATCAATATCTGCATCTGGCTGCTGTCGTCATCTGTTGGCA
TCTCTGCATAGTCCTTGGAGGCACAAAATAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000912
ORF Size 4959 bp
Insert Size 4700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000912.2, NP_000903
RefSeq Size 4959
RefSeq ORF 4959
Locus ID 4986
Cytogenetics 8q11.23
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations