PDHB (NM_000925) Human Untagged Clone

CAT#: SC119582

PDHB (untagged)-Human pyruvate dehydrogenase (lipoamide) beta (PDHB), nuclear gene encoding mitochondrial protein, transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PDHB (NM_000925) Human Untagged Clone
Symbol PDHB
Synonyms PDHBD; PDHE1-B; PHE1B
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119582 sequence for NM_000925 edited (data generated by NextGen Sequencing)
ATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGGGAGGTCTCCGGGCTGCTGAAG
AGGCGCTTTCACTGGACCGCGCCGGCTGCGCTGCAGGTGACAGTTCGTGATGCTATAAAT
CAGGGTATGGATGAGGAGCTGGAAAGAGATGAGAAGGTATTTCTGCTTGGAGAAGAAGTT
GCCCAGTATGATGGGGCATACAAGGTTAGTCGAGGGCTGTGGAAGAAATATGGAGACAAG
AGGATTATTGACACTCCCATATCAGAGATGGGCTTTGCTGGAATTGCTGTAGGTGCAGCT
ATGGCTGGGTTGCGGCCCATTTGTGAATTTATGACCTTCAATTTCTCCATGCAAGCCATT
GACCAGGTTATAAACTCAGCTGCCAAGACCTACTACATGTCTGGTGGCCTTCAGCCTGTG
CCTATAGTCTTCAGGGGGCCCAATGGTGCCTCAGCAGGTGTAGCTGCCCAGCACTCACAG
TGCTTTGCTGCCTGGTATGGGCACTGCCCAGGCTTAAAGGTGGTCAGTCCCTGGAATTCA
GAGGATGCTAAAGGACTTATTAAATCAGCCATTCGGGATAACAATCCAGTGGTGGTGCTA
GAGAATGAATTGATGTATGGGGTTCCTTTTGAATTTCCTCCGGAAGCTCAGTCAAAAGAT
TTTCTGATTCCTATTGGAAAAGCCAAAATAGAAAGGCAAGGAACACATATAACTGTGGTT
TCCCATTCAAGACCTGTGGGCCACTGCTTAGAAGCTGCAGCAGTGCTATCTAAAGAAGGA
GTTGAATGTGAGGTGATAAATATGCGTACCATTAGACCAATGGACATGGAAACCATAGAA
GCCAGTGTCATGAAGACAAATCATCTTGTAACTGTGGAAGGAGGCTGGCCACAGTTTGGA
GTAGGAGCTGAAATCTGTGCCAGGATCATGGAAGGTCCTGCGTTCAATTTCCTGGATGCT
CCTGCTGTTCGTGTCACTGGTGCTGATGTCCCTATGCCTTATGCAAAGATTCTAGAGGAC
AACTCTATACCTCAGGTCAAAGACATCATATTTGCAATAAAGAAAACATTAAATATTTAG

Clone variation with respect to NM_000925.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000925 unedited
GGCGCTGGTNNACCCNCCTTTTTTCCCCCCNNGGGTTCAAATTTGTATACGACTCACTAT
AGGCGGCCCGCGAATTCGCACGAGGCCTCGTGCCGAATTCGGCACGAGGGACACGACCAA
GATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGGGAGGTCTCCGGGCTGCTGAA
GAGGCGCTTTCACTGGACCGCGCCGGCTGCGCTGCAGGTGACAGTTCGTGATGCTATAAA
TCAGGGTATGGATGAGGAGCTGGAAAGAGATGAGAAGGTATTTCTGCTTGGAGAAGAAGT
TGCCCAGTATGATGGGGCATACAAGGTTAGTCGAGGGCTGTGGAAGAAATATGGAGACAA
GAGGATTATTGACACTCCCATATCAGAGATGGGCTTTGCTGGAATTGCTGTAGGTGCAGC
TATGGCTGGGTTGCGGCCCATTTGTGAATTTATGACCTTCAATTTCTCCATGCAAGCCAT
TGACCAGGTTATAAACTCAGCTGCCAAGACCTACTACATGTCTGGTGGCCTTCAGCCTGT
GCCTATAGTCTTCAGGGGGCCCAATGGTGCCTCAGCAGGTGTAGCTGCCCAGCACTCACA
GTGCTTTGCTGCCTGGTATGGGCACTGCCCAGGCTTAAAGGTGGTCAGTCCCTGGAATTC
AGAGGATGCTAAAGGACTTATTAAATCAGCCATTCGGGATAACAATCCAGTGGTGGTGCT
AGAGAATGAATTGATGTATGGNGTTTCCTTTTGAATTTCCTCCGGNAGCTCAGTCAAAAG
ATTTTCTGATTCCTATTGGAAAAGCCCAAATAGAAAGGCCAGGGACACATATTACTGTGG
GTTTCCCATTCAGGACTGTGGGCCACTGCTTAAAAACTGCCACAGTGCTATCTAAGAAAG
AGTGAATGTTGAGTGATAATTTGCGTACCTTTAGACAATGGACATGGAACCATANAACCC
TTGTCATGAGAC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000925 unedited
ACTTCCAGGGCCGGNAGAGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGATCTGTTC
AGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGTA
AACGTATATTATATGCTTTAATTTTATACATATAAGTTATCTTGTTTGGATACATCTTTC
ATCAGGACTCTGCCACATCCATACTTTGTCCTTGTGGTGAGAGAGGATAAAATGTTATAT
AATTTGTTATTCAAAGAACATGGCAACCGTAACAGACAAAAGGAAGCATGGCATCTAGGG
GAGGAGAGTGGAGAGTTTTCCATACACAAACACATTTAAACTTCCCTGTACAAAAATACC
TGCTGTTGCTTTAGAAATCATTTTCCGTTATGAATAGTCAGGTCTTGCAGTACAAATCCA
GGNNCAGTGCCAGCAAGTATTTCAAATAAATTTCAACGACTTGATATTCAAGTCCAAACT
AAATATTTAATGTTTTCTTTATTGCAAATATGATGTCTTTGACCTGAGGTATAGAGTTGT
CCTCTAGAATCTTTGCATAAGGCATAGGGACATCAGCACCAGTGACACGAACAGCAGGAG
CATCCAGGAAATTGAACGCAGGACCTTCCATGATCCTGGCACAGATTTCAGCTCCTACTC
CAAACTGTGGCCAGCCTCCTTCCACAGTTACAAGATGATTTTGTCTTCATGACACTGGCT
TCTATGGTTTCCATGTCCATTGGTCTAATGNNNNNCATATTTATCACCTCACATTNCACT
NCTTCTTAGATAGCACTGCTGCAGCTTCTAGCAGTGGCCCACAGGTCTTGATGGGNAAAC
CCAGNTATATGNNGTTCCTTGCCTTTCTATTTTGGNCTTTCCAATANGATCANAAAACTN
TTGACTGAGCTTCCGGAGAANTCAAAAGGACCCCATACATAATCATTCTCTACCACACAC
TGGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000925
ORF Size 1080 bp
Insert Size 1530
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000925.1, NP_000916
RefSeq Size 1501
Locus ID 5162
Cytogenetics 3p14.3
Domains transket_pyr, transketolase_C
Protein Pathways Glycolysis / Gluconeogenesis, Citrate cycle (TCA cycle), Valine, leucine and isoleucine biosynthesis, Pyruvate metabolism, Butanoate metabolism, Metabolic pathways
Gene Summary The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and carbon dioxide, and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 beta subunit. Mutations in this gene are associated with pyruvate dehydrogenase E1-beta deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2012].
Transcript Variant: This variant (1) represents the predominant transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.