Serotonin transporter(SLC6A4) (NM_001045) Human Untagged Clone

CAT#: SC119478

SLC6A4 (untagged)-Human solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 (SLC6A4)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Serotonin transporter(SLC6A4) (NM_001045) Human Untagged Clone
Symbol SLC6A4
Synonyms 5-HTT; 5-HTTLPR; 5HTT; hSERT; HTT; OCD1; SERT; SERT1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119478 sequence for NM_001045 edited (data generated by NextGen Sequencing)
ATGGAGACGACGCCCTTGAATTCTCAGAAGCAGCTATCAGCGTGTGAAGATGGAGAAGAT
TGTCAGGAAAACGGAGTTCTACAGAAGGTTGTTCCCACCCCAGGGGACAAAGTGGAGTCC
GGGCAAATATCCAATGGGTACTCAGCAGTTCCAAGTCCTGGTGCGGGAGATGACACACGG
CACTCTATCCCAGCGACCACCACCACCCTAGTGGCTGAGCTTCATCAAGGGGAACGGGAG
ACCTGGGGCAAGAAGGTGGATTTCCTTCTCTCAGTGATTGGCTATGCTGTGGACCTGGGC
AATGTCTGGCGCTTCCCCTACATATGTTACCAGAATGGAGGGGGGGCATTCCTCCTCCCC
TACACCATCATGGCCATTTTTGGGGGAATCCCGCTCTTTTACATGGAGCTCGCACTGGGA
CAGTACCACCGAAATGGATGCATTTCAATATGGAGGAAAATCTGCCCGATTTTCAAAGGG
ATTGGTTATGCCATCTGCATCATTGCCTTTTACATTGCTTCCTACTACAACACCATCATG
GCCTGGGCGCTATACTACCTCATCTCCTCCTTCACGGACCAGCTGCCCTGGACCAGCTGC
AAGAACTCCTGGAACACTGGCAACTGCACCAATTACTTCTCCGAGGACAACATCACCTGG
ACCCTCCATTCCACGTCCCCTGCTGAAGAATTTTACACGCGCCACGTCCTGCAGATCCAC
CGGTCTAAGGGGCTCCAGGACCTGGGGGGCATCAGCTGGCAGCTGGCCCTCTGCATCATG
CTGATCTTCACTGTTATCTACTTCAGCATCTGGAAAGGCGTCAAGACCTCTGGCAAGGTG
GTGTGGGTGACAGCCACCTTCCCTTATATCATCCTTTCTGTCCTGCTGGTGAGGGGTGCC
ACCCTCCCTGGAGCCTGGAGGGGTGTTCTCTTCTACTTGAAACCCAATTGGCAGAAACTC
CTGGAGACAGGGGTGTGGATAGATGCAGCCGCTCAGATCTTCTTCTCTCTTGGTCCGGGC
TTTGGGGTCCTGCTGGCTTTTGCTAGCTACAACAAGTTCAACAACAACTGCTACCAAGAT
GCCCTGGTGACCAGCGTGGTGAACTGCATGACGAGCTTCGTTTCGGGATTTGTCATCTTC
ACAGTGCTCGGTTACATGGCTGAGATGAGGAATGAAGATGTGTCTGAGGTGGCCAAAGAC
GCAGGTCCCAGCCTCCTCTTCATCACGTATGCAGAAGCGATAGCCAACATGCCAGCGTCC
ACTTTCTTTGCCATCATCTTCTTTCTGATGTTAATCACGCTGGGCTTGGACAGCACGTTT
GCAGGCTTGGAGGGGGTGATCACGGCTGTGCTGGATGAGTTCCCACACGTCTGGGCCAAG
CGCCGGGAGCGGTTCGTGCTCGCCGTGGTCATCACCTGCTTCTTTGGATCCCTGGTCACC
CTGACTTTTGGAGGGGCCTACGTGGTGAAGCTGCTGGAGGAGTATGCCACGGGGCCCGCA
GTGCTCACTGTCGCGCTGATCGAAGCAGTCGCTGTGTCTTGGTTCTATGGCATCACTCAG
TTCTGCAGGGACGTGAAGGAAATGCTCGGCTTCAGCCCGGGGTGGTTCTGGAGGATCTGC
TGGGTGGCCATCAGCCCTCTGTTTCTCCTGTTCATCATTTGCAGTTTTCTGATGAGCCCG
CCACAACTACGACTTTTCCAATATAATTATCCTTACTGGAGTATCATCTTGGGTTACTGC
ATAGGAACCTCATCTTTCATTTGCATCCCCACATATATAGCTTATCGGTTGATCATCACT
CCAGGGACATTTAAAGAGCGTATTATTAAAAGTATTACCCCAGAAACACCAACAGAAATT
CCTTGTGGGGACATCCGCTTGAATGCTGTGTAA

Clone variation with respect to NM_001045.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001045 unedited
GCGTCAGCATTTGTAAACGACTCATATAGGGCGGCCGCGAATTCGCACCAGGTCCCTCCC
CTCCTGGCTCTGGGGTCGGGCGCGCACCCCGCCCCGTAGCGCGGCCCCTCCCTGGCGAGC
GCAACCCCATCCAGCGGGAGCGCGGAGCCGCGGCCGCGGGGAAGCATTAAGTTTATTCGC
CTCAAAGTGACGCAAAAATTCTTCAAGAGCTCTTTGGCGGCGGCTATCTAGAGATCAGAC
CATGTGAGGGCCCGCGGGTACAAATACGGCCGCGCCGGCGCCCCTCCGCACAGCCAGCGC
CGCCGGGTGCCTCGAGGGCGCGAGGCCAGCCCGCCTGCCCAGCCCGGGACCAGCCTCCCC
GCGCAGCCTGGCAGAGTCAATCCCGACGTGTCAATCCCGACGATAGAGAGCTCGGAGGTG
ATCCACAAATCCAAGCACCCAGAGATCAATTGGGATCCTTGGCAGATGGACATCAGTGTC
ATTTACTAACCAGCAGGATGGAGACGACGCCCTTGAATTCTCAGAAGCAGCTATCAGCGT
GTGAAGATGGAGAAGATTGTCAGGAAAACGGAGTTCTACAGAAGGTTGTTCCCACCCCAG
GGGACAAAGTGGAGTCCGGGCAAATATCCAATGGGTACTCAGCAGTTCCAAGTCCTGGTG
CGGGAGATGACACACGGCACTCTATCCCAGCGACCACCACCACCCTAGTGGCTGAGCTTC
ATCAGGGGGAACGGGAGACCTGGGGCAAGAAGGTGGGATTTCCTCTCTCAGTGATGGGCT
ATGCTGTGGACCTGGCAATGTCTGGCGCTTCCCCTACTATGTTACCAGAATGGAGGGNGG
GGCATTCTNCTNCCCTAAACATCATGGGCATTTTTGGGGAAATCCGCTCTTTTACTGGAG
CTCGCACTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001045 unedited
AAATACTATGGATCGCTGTCCGCATCTCTAGTTGTTTTTTTTTTTTTTTTTTTTGAGTTG
GTAGAATTTGTTACTGTAAGAAAAATTGGGGAATTCATATATTTGTAATGGGCCCAAAAT
ATTGGACTAGAGATAAGAATACACTGGAAACAACAATATACACAGACTCACAAGCTTGCA
TGGACACACTATTTTTCATTTTAGCTTCTTACATCTTCCTTTCCTGATGCCACAGCAGCA
CATGGATTAGAAGGTTCTAGTAGATTCCAGCAATAAAATTCTATATGCTACTCAGAAAAT
ATATGGCTAGCGAGATAGCATCCCTGTTCTCTCCTACGCAGTTTACGTATTCATGAACAG
TGAAACCTTTAGAAGCAAACAGATATCAGATACCAATGATCATACCAAGAAATGATACAG
GAGACTTTCACAGACTTGATTCTAAACCTAATCCTAACTGATGATAGGGTGGTTTTCATC
ACCTCCATCCACATCCTCACACGTCCAAAATAGGCCAGCTCAGCTGTGTCACAGTCTACC
ATGGGAATATGTCCAGGGGAATCCATGGAAATAAGTGGCTGGAGGCCTTGAGTCTGGGCA
CCAGACTGTGTCCCTGTGGAGAATGCCCTTCCATCATCAGGCTTAGCTGGAAACTCATTC
ACTTGGGAGGGGAGAAGGCANGCGTGCCTCATCAGAACTGGGNAGAGANGNTGTGGANAA
ACCTTTTTCCTCTCGGTGAGTGTGTTACACAGCATTCAAGCGGATGTCCCCACAAAGAAT
TTCTGGTGGTGGTTTCTGGGGTAATACCTTNTAATAANTACGCTCTTTAAATGTCCCTGG
AGTGATGATCAACCGATNAGCTATATATGTGGGGGATGCAAATGAAAGATGAGGT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001045
ORF Size 1893 bp
Insert Size 3100
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001045.2, NP_001036
RefSeq Size 2756
RefSeq ORF 1893
Locus ID 6532
Cytogenetics 17q11.2
Domains SNF, 5HT_transporter
Protein Families Transmembrane, Druggable Genome
Gene Summary This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake and may play a role in sudden infant death syndrome, aggressive behavior in Alzheimer disease patients, and depression-susceptibility in people experiencing emotional trauma. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations