AFM (NM_001133) Human Untagged Clone

CAT#: SC119416

AFM (untagged)-Human afamin (AFM)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name AFM (NM_001133) Human Untagged Clone
Symbol AFM
Synonyms ALB2; ALBA; ALF
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119416 sequence for NM_001133 edited (data generated by NextGen Sequencing)
ATGAAACTACTAAAACTTACAGGTTTTATTTTTTTCTTGTTTTTTTTGACTGAATCCCTA
ACCCTGCCCACACAACCTCGGGATATAGAGAACTTCAATAGTACTCAAAAATTTATAGAA
GATAATATTGAATACATCACCATCATTGCATTTGCTCAGTATGTTCAGGAAGCAACCTTT
GAAGAAATGGAAAAGCTGGTGAAAGACATGGTAGAATACAAAGACAGATGTATGGCTGAC
AAGACGCTCCCAGAGTGTTCAAAATTACCTAATAATGTTTTACAGGAAAAAATATGTGCT
ATGGAGGGGCTGCCACAAAAGCATAATTTCTCACACTGCTGCAGTAAGGTTGATGCTCAA
AGAAGACTCTGTTTCTTCTATAACAAGAAATCTGATGTGGGATTTCTGCCTCCTTTCCCT
ACCCTGGATCCCGAAGAGAAATGCCAGGCTTATGAAAGTAACAGAGAATCCCTTTTAAAT
CACTTTTTATATGAAGTTGCCAGAAGGAACCCATTTGTCTTCGCCCCTACACTTCTAACT
GTTGCTGTTCATTTTGAGGAGGTGGCCAAATCATGTTGTGAAGAACAAAACAAAGTCAAC
TGCCTTCAAACAAGGGCAATACCTGTCACACAATATTTAAAAGCATTTTCTTCTTATCAA
AAACATGTCTGTGGGGCACTTTTGAAATTTGGAACCAAAGTTGTACACTTTATATATATT
GCGATACTCAGTCAAAAATTCCCCAAGATTGAATTTAAGGAGCTTATTTCTCTTGTAGAA
GATGTTTCTTCCAACTATGATGGATGCTGTGAAGGGGATGTTGTGCAGTGCATCCGTGAC
ACGAGCAAGGTTATGAACCATATTTGTTCAAAACAAGATTCTATCTCCAGCAAAATCAAA
GAGTGCTGTGAAAAGAAAATACCAGAGCGCGGCCAGTGCATAATTAACTCAAACAAAGAT
GATAGACCAAAGGATTTATCTCTAAGAGAAGGAAAATTTACTGACAGTGAAAATGTGTGT
CAAGAACGAGATGCTGACCCAGACACCTTCTTTGCGAAGTTTACTTTTGAATACTCAAGG
AGACATCCAGACCTGTCTATACCAGAGCTTTTAAGAATTGTTCAAATATACAAAGATCTC
CTGAGAAATTGCTGCAACACAGAAAACCCTCCAGGTTGTTACCGTTACGCGGAAGACAAA
TTCAATGAGACAACTGAGAAAAGCCTCAAGATGGTACAACAAGAATGTAAACATTTCCAG
AATTTGGGGAAGGATGGTTTGAAATACCATTACCTCATTAGGCTCACGAAGATAGCTCCC
CAACTCTCCACTGAAGAACTGGTGTCTCTTGGCGAGAAAATGGTGACAGCTTTCACTACT
TGCTGTACGCTAAGTGAAGAGTTTGCCTGTGTTGATAATTTGGCAGATTTAGTTTTTGGA
GAGTTATGTGGAGTAAATGAAAATCGAACTATCAACCCTGCTGTGGACCACTGCTGTAAA
ACAAACTTTGCCTTCAGAAGGCCCTGCTTTGAGAGTTTGAAAGCTGATAAAACATATGTG
CCTCCACCTTTCTCTCAAGATTTATTTACCTTTCACGCAGACATGTGTCAATCTCAGAAT
GAGGAGCTTCAGAGGAAGACAGACAGGTTTCTTGTCAACTTAGTGAAGCTGAAGCATGAA
CTCACAGATGAAGAGCTGCAGTCTTTGTTTACAAATTTCGCAAATGTAGTGGATAAGTGC
TGCAAAGCAGAGAGTCCTGAAGTCTGCTTTAATGAAGAGAGTCCAAAAATTGGCAACTGA

Clone variation with respect to NM_001133.2
1299 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001133 unedited
NGGCGGTTCAGAATTGTATACGACTCACTATAGGGCGGCCGCGAATTCGCACCAGCAAAA
ATGAAACTACTAAAACTTACAGGTTTTATTTTTTTCTTGTTTTTTTTGACTGAATCCCTA
ACCCTGCCCACACAACCTCGGGATATAGAGAACTTCAATAGTACTCAAAAATTTATAGAA
GATAATATTGAATACATCACCATCATTGCATTTGCTCAGTATGTTCAGGAAGCAACCTTT
GAAGAAATGGAAAAGCTGGTGAAAGACATGGTAGAATACAAAGACAGATGTATGGCTGAC
AAGACGCTCCCAGAGTGTTCAAAATTACCTAATAATGTTTTACAGGAAAAAATATGTGCT
ATGGAGGGGCTGCCACAAAAGCATAATTTCTCACACTGCTGCAGTAAGGTTGATGCTCAA
AGAAGACTCTGTTTCTTCTATAACAAGAAATCTGATGTGGGATTTCTGCCTCCTTTCCCT
ACCCTGGATCCCGAAGAGAAATGCCAGGCTTATGAAAGTAACAGAGAATCCCTTTTAAAT
CACTTTTTATATGAAGTTGCCAGAAGGAACCCATTTGTCTTCGCCCCTACACTTCTAACT
GTTGCTGTTCATTTTGAGGAGGTGGCCAAATCATGTTGTGAAGAACAAAACAAAGTCAAC
TGCCTTCAAACAAGGGCAATACCTGTCACACAATATTTAAAAGCATTTTCTTCTTATCAA
AACATGTCTGTGGGGCACTTTTGAAATTTGGAACCAAAGTTGTACACTTTATATATATTG
CGATACTCAGTCAAAAATTCCCCAAGATTGAATNTAAGGGAGCTATTTNCTCTTGTANAA
GATGTTTCTTCCACTATGATGNATGCTGTGAAGGGGGAATGTTGTGCANNTGCATTCCGT
GACACGAGCAGGNTAT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001133 unedited
TTTGCCCCAAATTACGTTGNACCGGCCCGTATACTAGATCGAGTTTTCTTTTTTTTTTTT
TTTTTTTTTTTTTTTAACTTTACAAAAGTTGTGTTTATTGCTTGCTGCAATGTATTATTT
CAGGTGACAGTTACAGAAAAATCCTTTTATTTTGTTCTCAGGAAATGCGATTCATCACCA
CACAGATAGGAAGCCTTCCCTTTGGTGCTTTTTTTTTTACATATCTCCAGCAGCTGGCTT
CAGTTGCCAATTTTTGGACTCTCTTCATTAAAGCAGACTTCAGGACTCTCTGCTTTGCAG
CACTTATCCACTACATTTGCGAAATTTGTAAACAAAGACTGCAGCTCTTCATCTGTGAGT
TCATGCTTCAGCTTCACTAAGTTGACAAGAAACCTGTCTGTCTTCCTCTGAAGCTCCTCA
TTCTGAGATTGACACATGTCTGCGTGAAAGGTAAATAAATCTTGAGAGAAAGGTGGAGGC
ACATATGTTTTATCAGCTTTCAAACTCTCAAAGCAGGGCCTTCTGAAGGCAAAGTTTGTT
TTACAGCAGTGGTCCACAGCAGGGTTGATAGTTCGATTTTCATTTACTCCACATAACTCT
CCAAAAACTAAATCTGCCAAATTATCAACACAGGCAAACTCTTCACTTAGCGTACAGCAA
GTAGTGAAAGCTGTCACCATTTTCTCGCCAAGAGACACCAGTTCTTCAGTGGAGAGTTGG
GGAGCTATCTTCGTGAGCCTAATGAGGTAATGGTATTTCAAACCATCCTTCCCCAAATTC
TGGAAATGTTTACATTCTTGTTGTACCATCTTGAGGCTTTTCTCAGTTGCCTCAATGAAT
TTGTCA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001133
ORF Size 1800 bp
Insert Size 2300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001133.2, NP_001124
RefSeq Size 1997
RefSeq ORF 1800
Locus ID 173
Cytogenetics 4q13.3
Domains ALBUMIN
Protein Families Secreted Protein, Druggable Genome
Gene Summary This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.