Cathepsin O(CTSO) (NM_001334) Human Untagged Clone

CAT#: SC119312

CTSO (untagged)-Human cathepsin O (CTSO)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cathepsin O(CTSO) (NM_001334) Human Untagged Clone
Symbol CTSO
Synonyms CTSO1; CTSO1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119312 sequence for NM_001334 edited (data generated by NextGen Sequencing)
ATGGACGTGCGGGCGCTGCCGTGGCTGCCGTGGCTGCTGTGGCTGCTGTGCCGGGGCGGC
GGCGATGCGGACTCCCGCGCCCCCTTCACCCCGACCTGGCCGCGGAGCCGCGAGCGTGAA
GCCGCCGCCTTCCGGGAAAGTCTTAATAGACATCGATACTTGAATTCTTTATTTCCCAGT
GAAAACTCCACCGCCTTCTATGGAATAAATCAGTTTTCCTATTTGTTTCCTGAAGAGTTT
AAAGCCATTTATTTAAGAAGCAAACCTTCCAAGTTTCCCAGATACTCAGCAGAAGTACAT
ATGTCCATCCCCAATGTGTCTTTGCCGTTAAGATTTGACTGGAGGGACAAGCAGGTTGTG
ACACAAGTGAGAAACCAGCAGATGTGTGGAGGATGCTGGGCCTTCAGCGTGGTGGGGGCA
GTGGAATCTGCTTATGCAATAAAGGGGAAGCCCCTGGAAGACCTAAGTGTCCAGCAGGTC
ATTGACTGTTCGTATAATAATTATGGCTGCAATGGAGGCTCTACTCTCAATGCTTTGAAC
TGGTTAAACAAGATGCAAGTAAAACTGGTGAAAGATTCAGAATATCCTTTTAAAGCACAA
AATGGTCTGTGCCATTACTTTTCTGGTTCACATTCTGGATTTTCAATCAAAGGTTATTCT
GCATATGACTTCAGTGACCAAGAAGATGAAATGGCAAAAGCACTTCTTACCTTTGGCCCT
TTGGTAGTCATAGTAGATGCAGTGAGCTGGCAAGATTATCTGGGAGGCATTATACAGCAT
CACTGCTCTAGTGGAGAAGCAAATCATGCAGTTCTCATAACTGGGTTTGATAAAACAGGA
AGCACTCCATATTGGATTGTGCGGAATTCCTGGGGAAGTTCTTGGGGAGTAGATGGTTAT
GCCCATGTCAAAATGGGAAGTAATGTTTGTGGTATTGCAGATTCCGTTTCTTCTATATTT
GTGTGA

Clone variation with respect to NM_001334.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001334 unedited
CCCATCGCACTCGCCGCAATGGACGTGCGGGCGCTGCCGTGGCTGCCGTGGCTGCTGTGG
CTGCTGTGCCGGGGCGGCGGCGATGCGGACTCCCGCGCCCCCTTCACCCCGACCTGGCCG
CGGAGCCGCGAGCGTGAAGCCGCCGCCTTCCGGGAAAGTCTTAATAGACATCTTGACTGG
AATTCTTTATTTCCCAGTGAAAACTCCACCGCCTTCTATGGAATAAATCAGTTTTCCTAT
TTGTTTCCTGAAGAGTTTAAAGCCATTTATTTAAGAAGCAAACCTTCCAAGTTTCCCAGA
TACTCAGCAGAAGTACATATGTCCATCCCCAATGTGTCTTTGCCGTTAAGATTTGACTGG
AGGGACAAGCAGGTTGTGACACAAGTGAGAAACCAGCAGATGTGTGGAGGATGCTGGGCC
TTCAGCGTGGTGGGGGCAGTGGAATCTGCTTATGCAATAAAGGGGAAGCCCCTGGAAGAC
CTAAGTGTCCAGCAGGTCATTGACTGTTCGTATAATAATTATGGCTGCAATGGAGGCTCT
ACTCTCAATGCTTTGAACTGGTTAAACAAGATGCAAGTAAAACTGGTGAAAGATTCAGAA
TATCCTTTTAAAGCACAAATGGTCTGTGCCATTACTTTTCTGGGTCACATTCTGGATTTT
CAATCAAAGGGTATTCTGCATATGACTTCGGTGACCAAGAAAAGAAATGGCAAAAGCACT
TTTTTACCTTGGCCCCTTTGGTAGGCATAGTAGATGCAAGGAGCCGGCAAGATTATCTGG
GAAGGCATTATCCACATCCCTGGTTCTGTGGGAGAGACAAATCAGCCCGTTTCATAACAG
GGGTTGGAAAACCGGGAGCACTCCTTTTGGAATGGGCCGAAATCCGGGGGAAATCTTGGG
GAATAAATGGTTTCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001334 unedited
TAGCTCTGAACCCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGTTAGAT
CATATACATTAGNAAAAGAATGATACATTTTTAGAGAAGAAATATGTACATACATAGTAT
CAGAAATAATTTTCTTGTATTGATTCATTTAATATGGTTGTGCTTATATTCAATCAGAAG
GTCAACTCCTTTGCTCTAAGGTTCTTACACTGCTAACAAGAAATGGCTTTTTTCCTGTTG
CAGGTCATGAGCAGCACACAGTGTCCTTTCTAGGCACATAGGATCATCGATCACTGTGTG
GACGCAGGCTAATCAGAATTGCACCTGAAATCACTTGTGCAATTAGTGATGCAAGAGTGA
TCACAGGAATCAAGACTGGGAGCCAAGAGAAAGAACAAGAGGTGCACAAAGAAGCAGTTC
GGATGGGAGACCAGGAAAGCTGAGGGGAAAACTGGGAAACAGATTCTGGAAAACTCACAG
TTTGTTTGATACCCAGGGTTAAGAGATGGGACTTTGATAGGAGTGGTGCTTATGAATTAA
GGGAGGAAGAAAGAGGTGAGATCCTAATGTTGGTAAAGGTACAGAGACAAAGGGAGCCAA
CCAAGTGGTAAGAAAATAGAAATGGAAAGTAAAAATGAGACTTAATTCTTTAGTCAGGGA
AGCCAAGCCACCAGGAAAACTTGGGTAGAGTAAGAGAAAGAAGGAGAAAATATGAGATAA
TATTTGGGATTTTGATATACTANAGAACAAATATTATTCTATTGTATAAAAAGAACAAAG
TAGCATATGACCTATGGATTCCTATTCACAAGAAAATATCAACATAATTTGCCTCTTAGC
ATGCTCCAAAATTACTCATTAATTGCCTATGGCCATTAATTCAATTAACCGAACGATTTG
CCCTTTCCTTCTTCACGGGCACTCGCGGTCAAGGGTAGAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001334
ORF Size 966 bp
Insert Size 2290
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001334.2, NP_001325
RefSeq Size 2943
RefSeq ORF 966
Locus ID 1519
Cytogenetics 4q32.1
Domains Peptidase_C1
Protein Families Protease, Druggable Genome
Protein Pathways Lysosome
Gene Summary The protein encoded by the gene is a cysteine proteinase and a member of the papain superfamily. This proteolytic enzyme is involved in cellular protein degradation and turnover. The recombinant form of this enzyme was shown to degrade synthetic peptides typically used as substrates for cysteine proteinases and its proteolytic activity was abolished by an inhibitor of cyteine proteinase. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations