BMP7 (NM_001719) Human Untagged Clone

CAT#: SC119058

BMP7 (untagged)-Human bone morphogenetic protein 7 (BMP7)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BMP7 (NM_001719) Human Untagged Clone
Symbol BMP7
Synonyms OP-1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001719, the custom clone sequence may differ by one or more nucleotides


ATGCACGTGCGCTCACTGCGAGCTGCGGCGCCGCACAGCTTCGTGGCGCTCTGGGCACCCCTGTTCCTGC
TGCGCTCCGCCCTGGCCGACTTCAGCCTGGACAACGAGGTGCACTCGAGCTTCATCCACCGGCGCCTCCG
CAGCCAGGAGCGGCGGGAGATGCAGCGCGAGATCCTCTCCATTTTGGGCTTGCCCCACCGCCCGCGCCCG
CACCTCCAGGGCAAGCACAACTCGGCACCCATGTTCATGCTGGACCTGTACAACGCCATGGCGGTGGAGG
AGGGCGGCGGGCCCGGCGGCCAGGGCTTCTCCTACCCCTACAAGGCCGTCTTCAGTACCCAGGGCCCCCC
TCTGGCCAGCCTGCAAGATAGCCATTTCCTCACCGACGCCGACATGGTCATGAGCTTCGTCAACCTCGTG
GAACATGACAAGGAATTCTTCCACCCACGCTACCACCATCGAGAGTTCCGGTTTGATCTTTCCAAGATCC
CAGAAGGGGAAGCTGTCACGGCAGCCGAATTCCGGATCTACAAGGACTACATCCGGGAACGCTTCGACAA
TGAGACGTTCCGGATCAGCGTTTATCAGGTGCTCCAGGAGCACTTGGGCAGGGAATCGGATCTCTTCCTG
CTCGACAGCCGTACCCTCTGGGCCTCGGAGGAGGGCTGGCTGGTGTTTGACATCACAGCCACCAGCAACC
ACTGGGTGGTCAATCCGCGGCACAACCTGGGCCTGCAGCTCTCGGTGGAGACGCTGGATGGGCAGAGCAT
CAACCCCAAGTTGGCGGGCCTGATTGGGCGGCACGGGCCCCAGAACAAGCAGCCCTTCATGGTGGCTTTC
TTCAAGGCCACGGAGGTCCACTTCCGCAGCATCCGGTCCACGGGGAGCAAACAGCGCAGCCAGAACCGCT
CCAAGACGCCCAAGAACCAGGAAGCCCTGCGGATGGCCAACGTGGCAGAGAACAGCAGCAGCGACCAGAG
GCAGGCCTGTAAGAAGCACGAGCTGTATGTCAGCTTCCGAGACCTGGGCTGGCAGGACTGGATCATCGCG
CCTGAAGGCTACGCCGCCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGAACTCCTACATGAACGCCA
CCAACCACGCCATCGTGCAGACGCTGGTCCACTTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGC
GCCCACGCAGCTCAATGCCATCTCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAATAC
AGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_001719 unedited
CGCCGTTGAGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGT
TTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCAC
CAGCCAGGGCGCACAAGGCTGGGAGAGCGCCCCGGGGCCCCTGCTATCCGCGCCGGAGGT
TGGAAGAGGGTGGGTTGCCGCCGCCCGAGGGCGAGAGCGCCAGAGGAGCGGGAAGAAGGA
GCGCTCGCCCGCCCGCCTGCCTCCTCGCTGCCTCCCCGGCGTTGGCTCTCTGGACTCCTA
GGCTTGCTGGCTGCTCCTCCCACCCGCGCCCGCCTCCTCACTCGCCTTTTCGTTCGCCGG
GGCTGCTTTCCAAGCCCTGCGGTGCGCCCGGGCGAGTGCGGGGCGAGGGGCCCGGGGCCA
GCACCGAGCAGGGGGCGGGGGTCCGGGCAGAGCGCGGCCGGCCGGGGAGGGGCCATGTCT
GGCGCGGGCGCAGCGGGGCCCGTCTGCAGCAAGTGACCGAGCGGCGCGGACGGCCGCCTG
CCCCCTCTGCCACCTGGGGCGGTGCGGGCCCGGAGCCCGGAGCCCGGGTAGCGCGTAGAG
CCGGCGCGATGCACGTGCGCTCACTGCGAGCTGCGGCGCCGCACAGCTTCGTGGCGCTCT
GGGCACCCCTGTTCCTGCTGCGCTCCGCCCTGGCCGACTTCAGCCTGGACAACGAGGTGC
ACTCGAGCTTCATCCACCGGCGCCTCCGCAGCCAGAGCGGCGGGAGATGCAGCGCGAGAT
CCTCCTCCATTTTGGGCTTGCCCCACCGCCCGCGCCCGCACCTCAGGGCAAGCACAACTC
GCACCCATGTTCATGCTGGACCTGTACAACGCCATGCGTGAGAGACGCGGCCCGCGCAGC
TCTCTACCTACAGCCGTCTTCAGTACCAGGCCCCCCCTTCTGGCAGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001719
ORF Size 1296 bp
Insert Size 4000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001719.1, NP_001710
RefSeq Size 1878
RefSeq ORF 1296
Locus ID 655
Cytogenetics 20q13.31
Domains TGFb_propeptide, TGF-beta
Protein Families Stem cell relevant signaling - TGFb/BMP signaling pathway, Secreted Protein, ES Cell Differentiation/IPS, Adult stem cells, Cancer stem cells, Embryonic stem cells, Induced pluripotent stem cells, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Hedgehog signaling pathway, TGF-beta signaling pathway
Gene Summary Induces cartilage and bone formation. May be the osteoinductive factor responsible for the phenomenon of epithelial osteogenesis. Plays a role in calcium regulation and bone homeostasis. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations