CBR1 (NM_001757) Human Untagged Clone

CAT#: SC119034

CBR1 (untagged)-Human carbonyl reductase 1 (CBR1)

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CBR1 (NM_001757) Human Untagged Clone
Symbol CBR1
Synonyms CBR; hCBR1; SDR21C1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119034 sequence for NM_001757 edited (data generated by NextGen Sequencing)
ATGTCGTCCGGCATCCATGTAGCGCTGGTGACTGGAGGCAACAAGGGCATCGGCTTGGCC
ATCGTGCGCGACCTGTGCCGGCTGTTCTCGGGGGACGTGGTGCTCACGGCGCGGGACGTG
ACGCGGGGCCAGGCGGCCGTACAGCAGCTGCAGGCGGAGGGCCTGAGCCCGCGCTTCCAC
CAGCTGGACATCGACGATCTGCAGAGCATCCGCGCCCTGCGCGACTTCCTGCGCAAGGAG
TACGGGGGCCTGGACGTGCTGGTCAACAACGCGGGCATCGCCTTCAAGGTTGCTGATCCC
ACACCCTTTCATATTCAAGCTGAAGTGACGATGAAAACAAATTTCTTTGGTACCCGAGAT
GTGTGCACAGAATTACTCCCTCTAATAAAACCCCAAGGGAGAGTGGTGAACGTATCTAGC
ATCATGAGCGTCAGAGCCCTTAAAAGCTGCAGCCCAGAGCTGCAGCAGAAGTTCCGCAGT
GAGACCATCACTGAGGAGGAGCTGGTGGGGCTCATGAACAAGTTTGTGGAGGATACAAAG
AAGGGAGTGCACCAGAAGGAGGGCTGGCCCAGCAGCGCATACGGGGTGACGAAGATTGGC
GTCACCGTTCTGTCCAGGATCCACGCCAGGAAACTGAGTGAGCAGAGGAAAGGGGACAAG
ATCCTCCTGAATGCCTGCTGCCCAGGGTGGGTGAGAACTGACATGGCGGGACCCAAGGCC
ACCAAGAGCCCAGAAGAAGGTGCAGAGACCCCTGTGTACTTGGCCCTTTTGCCCCCAGAT
GCTGAGGGTCCCCATGGACAATTTGTTTCAGAGAAGAGAGTTGAACAGTGGTGA

Clone variation with respect to NM_001757.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001757 unedited
TTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCTGGAACACGCTG
CGGGGCTCCCGGGCCTGAGCCAGGTCTGTTCTCCACGCAGGTGTTCCGCGCGCCCCGTTC
AGCCATGTCGTCCGGCATCCATGTAGCGCTGGTGACTGGAGGCAACAAGGGCATCGGCTT
GGCCATCGTGCGCGACCTGTGCCGGCTGTTCTCGGGGGACGTGGTGCTCACGGCGCGGGA
CGTGACGCGGGGCCAGGCGGCCGTACAGCAGCTGCAGGCGGAGGGCCTGAGCCCGCGCTT
CCACCAGCTGGACATCGACGATCTGCAGAGCATCCGCGCCCTGCGCGACTTCCTGCGCAA
GGAGTACGGGGGCCTGGACGTGCTGGTCAACAACGCGGGCATCGCCTTCAAGGTTGCTGA
TCCCACACCCTTTCATATTCAAGCTGAAGTGACGATGAAAACAAATTTCTTTGGTACCCG
AGATGTGTGCACAGAATTACTCCCTCTAATAAAACCCCAAGGGAGAGTGGTGAACGTATC
TAGCATCATGAGCGTCAGAGCCCTTAAAAGCTGCAGCCCAGAGCTGCAGCAGAAGTTCCG
CAGTGAGACCATCACTGAGGAGGAGCTGGTGGGGCTCATGAACAAGTTTGTGGAGGATAC
AAAGAAGGGAGTGCACCAGAAAGAGGGCTGGCCCAGCAGCGCATACGGGGTGACGAAGAT
TGGCGTCACCGTTCTGTCCAGGATCCACGCCAGAANACTGAGTGAGCAGAGGAAAGGGGN
ACAGATCCTNCTGAATGCCTGCTGCCCAGGTGGGTGAGAACTGACATGGCGGGACCCCAA
GCCACCAGAGCCCAGAAGAG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001757 unedited
TGGACCGCGCGCCGCAATCTAGCGTCGAGTTTTTTTTTTTTTTTTTTAACTTATAAAAAA
CCATTTATTCATCTGTTGATTTTCATTCATTATTTTCATCAATTACAATTTTTCCTCTCC
TGCATCAGAGGAAATCACAAAAGACCTGACAGATTTACGTAGTCAACTGAGTGCGTAGGT
TGCTCAATTAGTAGTACATTAGCGAGTGCTAATTGATAAGAGACCATTTTTTTTCTTATA
TAAGGATATTTATGACATTGTAAATGCCCTTTGGACCAACTAAGGACAAGGTACAAAATG
GGGCCCATGGATGGAGCCGCGAGCCCAGCTCACCACTGCTCACCTCTTTTCTCTGAACCA
AACTGCCCATGGGGACCCTCAGCATCTGGGGGCAAAAGGGCCACGTACACAGGGGTTTCT
GCACCTTCTTCTGGGCTCTTGGTGGCCTTGGGTCCCGCCATGTTAGCCCTTACCCACTCT
GCCTAGCAGGCATTCAGGACGATCCTGCCCCCTTCCCTCTGCTCACCCAGTTCCTCCGCG
TGGACCCTGGACCGAACGGTGCCGCCAATTTTTGTTATCCCGCCTGCGCTGCCGGGCCCC
CCTTCCTTTGGTGCACCCCCCTCCTTCTGCATCCCTCACACCTTTGTTCCTCGACCCCAA
CACTCCTTCCTAACGATGGGCTCCCCGCGGAACTTTTTGCTGCACCCTCGGGCTTTTACC
CCTAAGGCCTTTGACCTCATGATGTTCCACCCCCCAAACCTCTTCCTTGGGCCCTATTAC
CGGGATTACCCCGCCCCCCCCCTCCGGACTAAAAAACTCCTTTTCCCCGCACTTCCCCTC
CACTCGAACGCCGCGGATCACACCTCTTACGCCCGTCCTTCGTCTACCCCATCTTATTCC
CCTTTTTTTTTCCCATACCCCGCGTCCCCGTTCTTAATCCCTTGCCCATCGGGCACCCGC
CC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001757
ORF Size 834 bp
Insert Size 1250
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001757.2, NP_001748
RefSeq Size 1245
RefSeq ORF 834
Locus ID 873
Cytogenetics 21q22.12
Domains adh_short
Protein Families Druggable Genome
Protein Pathways Arachidonic acid metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene belongs to the short-chain dehydrogenases/reductases (SDR) family, which function as NADPH-dependent oxidoreductases having wide specificity for carbonyl compounds, such as quinones, prostaglandins, and various xenobiotics. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.