CD52 (NM_001803) Human Untagged Clone

CAT#: SC119027

Reviews ()
Write a review

CD52 (untagged)-Human CD52 molecule (CD52)



  "NM_001803" in other vectors (6)

Reconstitution Protocol

USD 429.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD52
Synonyms CDW52; EDDM5; HE5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC119027 sequence for NM_001803 edited (data generated by NextGen Sequencing)
ATGAAGCGCTTCCTCTTCCTCCTACTCACCATCAGCCTCCTGGTTATGGTACAGATACAA
ACTGGACTCTCAGGACAAAACGACACCAGCCAAACCAGCAGCCCCTCAGCATCCAGCAGC
ATGAGCGGAGGCATTTTCCTTTTCTTCGTGGCCAATGCCATAATCCACCTCTTCTGCTTC
AGTTGA

Clone variation with respect to NM_001803.2
119 a=>g;123 a=>g
>OriGene 5' read for NM_001803 unedited
AATTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCTAAAAAGCTGC
TACCAAGACAGCCACGAAGATCCTACCAAAATGAAGCGCTTCCTCTTCCTCCTACTCACC
ATCAGCCTCCTGGTTATGGTACAGATACAAACTGGACTCTCAGGACAAAACGACACCAGC
CAAACCAGCAGCCCCTCAGCATCCAGCAGCATGAGCGGAGGCATTTTCCTTTTCTTCGTG
GCCAATGCCATAATCCACCTCTTCTGCTTCAGTTGAGGTGACACGTCTCAGCCTTAGCCC
TGTGCCCCCTGAAACAGCTGCCACCATCACTCGCAAGAGAATCCCCTCCATCTTTGGGAG
GGGTTGATGCCAGACATCACCAGGTTGTAGAAGTTGACAGGCAGTGCCATGGGGGCAACA
GCCAAAATAGGGGGGTAATGATGTAGGGGCCAAGCAGTGCCCAGCTGGGGGTCAATAAAG
TTACCCTTGTACTTGCAAAAAAAAAAAAAAAAAACTCGACTCTAGATTGCGGCCGCGGTC
ATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTC
CTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGC
ATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGCGTGGAGGGGGGGTGGATGG
GAGCAAGGGGCAAGTTGGGAAAACACCTGTTGGGCCTGCGGGGTCTATTGGAACCAAGCT
GAGTGCGGGGCACATCTGGTTCACTGAATCTCCCCTCCTGGGTTAAGCGATCTCTGCCCA
GCCTCCCAATGGTGGGATTCAGGCTTGCGGACCAGCTCACTAATTTTTGTTCTTTGGAAA
ACAGGGGTCCAC
>OriGene 3' read for NM_001803 unedited
TGAACCGCGCGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTGCAAGTACAAGGG
TAACTTTATTGACCCCCAGCTGGGCACTGCTTGGCCCCTACATCATTACCCCCCTATTTT
GGCTGTTGCCCCCATGGCACTGCCTGTCAACTTCTACAACCTGGTGATGTCTGGCATCAA
CCCCTCCCAAAGATGGAGGGGATTCTCTTGCGAGTGATGGTGGCAGCTGTTTCAGGGGGC
ACAGGGCTAAGGCTGAGACGTGTCACCTCAACTGAAGCAGAAGAGGTGGATTATGGCATT
GGCCACGAAGAAAAGGAAAATGCCTCCGCTCATGCTGCTGGATGCTGAGGGGCTGCTGGT
TTGGCTGGTGTCGTTTTGTCCTGAGAGTCCAGTTTGTATCTGTACCATAACCAGGAGGCT
GATGGTGAGTAGGAGGAAGAGGAAGCGCTTCATTTTGGTAGGATCTTCGTGGCTGTCTTG
GTAGCAGCTTTTTAGCCTCGTGCCGAATTCGCGGCCGCCCTATAGTGAGTCGTATTACAA
AATTCTGACGGTTCACTAAACGAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTAC
CGCCCATTTGCGTCAACGCGGCGGGGTTATTACGACATTTTGGAAAGTCCCGGTGATTTT
GGTGCCCAAACAAACTCCCATTGACCTCAATGGGGTGGAGACTTGGAAATCTCCGTGAGT
CAAACCGCTATCCACGCCCATTGGTGTACCTGCAAAACCGCACACCCATGGGAATACCGA
TGACTAATACGTAGATGTACTGGCAAGTACGAAAATCCCGCGAAGGCATGTCCTGGGCAT
AATGCCCAGCCGGGCCATTTACCGCCCATTGACCGCATAAGGGGGCCGGACCTTGGCATA
TAGAAACCCCTGGATGTACCTGGCAGTGGGGCAGACTTCN
Restriction Sites NotI-NotI     
ACCN NM_001803
Insert Size 460 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001803.2, NP_001794.2
RefSeq Size 523 bp
RefSeq ORF 186 bp
Locus ID 1043
UniProt ID P31358
Cytogenetics 1p36.11
Protein Families Transmembrane
Gene Summary May play a role in carrying and orienting carbohydrate, as well as having a more specific role.[UniProtKB/Swiss-Prot Function]

Other Versions

Other products for "CD52"
Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00


CD52 rabbit polyclonal antibody
    • 25 ul

USD 800.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.