FOXO1 (NM_002015) Human Untagged Clone

CAT#: SC118890

FOXO1 (untagged)-Human forkhead box O1 (FOXO1)

USD 505.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FOXO1 (NM_002015) Human Untagged Clone
Symbol FOXO1
Synonyms FKH1; FKHR; FOXO1A
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_002015 edited
ATGGCCGAGGCGCCTCAGGTGGTGGAGATCGACCCGGACTTCGAGCCGCTGCCCCGGCCG
CGCTCGTGCACCTGGCCGCTGCCCAGGCCGGAGTTTAGCCAGTCCAACTCGGCCACCTCC
AGCCCGGCGCCGTCGGGCAGCGCGGCTGCCAACCCCGACGCCGCGGCGGGCCTGCCCTCG
GCCTCGGCTGCCGCTGTCAGCGCCGACTTCATGAGCAACCTGAGCTTGCTGGAGGAGAGC
GAGGACTTCCCGCAGGCGCCCGGCTCCGTGGCGGCGGCGGTGGCGGCGGCGGCCGCCGCG
GCCGCCACCGGGGGGCTGTGCGGGGACTTCCAGGGCCCGGAGGCGGGCTGCCTGCACCCA
GCGCCACCGCAGCCCCCGCCGCCCGGGCCGCTGTCGCAGCACCCGCCGGTGCCCCCCGCC
GCCGCTGGGCCGCTCGCGGGGCAGCCGCGCAAGAGCAGCTCGTCCCGCCGCAACGCGTGG
GGCAACCTGTCCTACGCCGACCTCATCACCAAGGCCATCGAGAGCTCGGCGGAGAAGCGG
CTCACGCTGTCGCAGATCTACGAGTGGATGGTCAAGAGCGTGCCCTACTTCAAGGATAAG
GGTGACAGCAACAGCTCGGCGGGCTGGAAGAATTCAATTCGTCATAATCTGTCCCTACAC
AGCAAGTTCATTCGTGTGCAGAATGAAGGAACTGGAAAAAGTTCTTGGTGGATGCTCAAT
CCAGAGGGTGGCAAGAGCGGGAAATCTCCTAGGAGAAGAGCTGCATCCATGGACAACAAC
AGTAAATTTGCTAAGAGCCGAAGCCGAGCTGCCAAGAAGAAAGCATCTCTCCAGTCTGGC
CAGGAGGGTGCTGGGGACAGCCCTGGATCACAGTTTTCCAAATGGCCTGCAAGCCCTGGC
TCTCACAGCAATGATGACTTTGATAACTGGAGTACATTTCGCCCTCGAACTAGCTCAAAT
GCTAGTACTATTAGTGGGAGACTCTCACCCATTATGACCGAACAGGATGATCTTGGAGAA
GGGGATGTGCATTCTATGGTGTACCCGCCATCTGCCGCAAAGATGGCCTCTACTTTACCC
AGTCTGTCTGAGATAAGCAATCCCGAAAACATGGAAAATCTTTTGGATAATCTCAACCTT
CTCTCATCACCAACATCATTAACTGTTTCGACCCAGTCCTCACCTGGCACCATGATGCAG
CAGACGCCGTGCTACTCGTTTGCGCCACCAAACACCAGTTTGAATTCACCCAGCCCAAAC
TACCAAAAATATACATATGGCCAATCCAGCATGAGCCCTTTGCCCCAGATGCCTATACAA
ACACTTCAGGACAATAAGTCGAGTTATGGAGGTATGAGTCAGTATAACTGTGCGCCTGGA
CTCTTGAAGGAGTTGCTGACTTCTGACTCTCCTCCCCATAATGACATTATGACACCAGTT
GATCCTGGGGTAGCCCAGCCCAACAGCCGGGTTCTGGGCCAGAACGTCATGATGGGCCCT
AATTCGGTCATGTCAACCTATGGCAGCCAGGTATCTCATAACAAAATGATGAATCCCAGC
TCCCATACCCACCCTGGACATGCTCAGCAGACATCTGCAGTTAACGGGCGTCCCCTGCCC
CACACGGTAAGCACCATGCCCCACACCTCGGGTATGAACCGCCTGACCCAAGTGAAGACA
CCTGTACAAGTGCCTCTGCCCCACCCCATGCAGATGAGTGCCCTGGGGGGCTACTCCTCC
GTGAGCAGCTGCAATGGCTATGGCAGAATGGGCCTTCTCCACCAGGAGAAGCTCCCAAGT
GACTTGGATGGCATGTTCATTGAGCGCTTAGACTGTGACATGGAATCCATCATTCGGAAT
GACCTCATGGATGGAGATACATTGGATTTTAACTTTGACAATGTGTTGCCCAACCAAAGC
TTCCCACACAGTGTCAAGACAACGACACATAGCTGGGTGTCAGGCTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002015 unedited
CTATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGAGTCGCAGCA
GCCGCTGCCGCAGCCGCCACATTCAACAGGCAGCAGCGCAGCGGGCGCGCCGCTGGGGAG
AGCAAGCGGCCCGCGGCGTCCGTCCGTCCTTCCGTCCGCGGCCCTGTCAGCTGGAGCGCG
GCGCAGGCTCTGCCCCGGCCCGGCGGCTCTGGCCGGCCGTCCAGTCCGTGCGGCGGACCC
CGAGGAGCCTCGATGTGGATGGCCCCGCGAAGTTAAGTTCTGGGCTCGCGCTTCCACTCC
GCCGCGCCTTCCTCCCAGTTTCCGTCCGCTCGCCGCACCGGCTTCGTTCCCCCAAATCTC
GGACCGTCCCTTCGCGCCCCCTCCCCGTCCGCCCCCAGTGCTGCGTTCTCCCCCTCTTGG
CTCTCCTGCGGCTGGGGGAGGGGCGGGGGTCACCATGGCCGAGGCGCCTCAGGTGGTGGA
GATCGACCCGGACTTCGAGCCGCTGCCCCGGCCGCGCTCGTGCACCTGGCCGCTGCCCAG
GCCGGAGTTTAGCCAGTCCAACTCGGCCACCTCCAGCCCGGCGCCGTCGGGCAGCGCGGC
TGCCAACCCCGACGCCGCGGCGGGCCTGCCCTCGGCCTCGGCTGCCGCTGTCAGCGCCGA
CTTCATGAGCAACCTGAGCTTGCTGGAGGAGAGCGAGGACTTNNCCGCAGCGCCCGGCTC
CGTGGCGGCGGCGGGGGCGGNCGGCGGCCGCCCGCGGCCGNCACCGGNGGGGCTGTGCGG
GGACTTCCAGGCCCCGGGAGGGCGGGCTGGCTGCACCCAAGCCACCGAAGCCCCGCCGNC
CGGGCCGCTGTCGCACAACCCGCCGTTGCCCCCGCCGCCGCTGGGCCCTTCCGGGGCAAC
CGCGCAGTACCATTTGTCCCGCGCACACGGTGGGGGAACCTGTCTACGCCGACTTATACC
AAGCCACGAAGCTCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002015 unedited
TAGGAAACTAAAGGGCAGTTGTGTGAAGNACTCTTTGGACTGCTTCTCTCAGTTCCTGCT
GTCAGACAATCTGAAGTACTTTTAAGTGTAACCTGCTCACTAACCCTCAGCCTGACACCC
AGCTATGTGTCGTTGTCTTGACACTGTGTGGGAAGCTTTGGTTGGGCAACACATTGTCAA
AGTTAAAATCCAATGTATCTCCATCCATGAGGTCATTCCGAATGATGGATTCCATGTCAC
AGTCTAAGCGCTCAATGAACATGCCATCCAAGTCACTTGGGAGCTTCTCCTGGTGGAGAA
GGCCCATTCTGCCATAGCCATTGCAGCTGCTCACGGAGGAGTAGCCCCCCAGGGCACTCA
TCTGCATGGGGTGGGGCAGAGGCACTTGTACAGGTGTCTTCACTTGGGTCAGGCGGTTCA
TACCCGAGGTGTGGGGCATGGTGCTTACCGTGTGGGGCAGGGGACGCCCGTTAACTGCAG
ATGTCTGCTGAGCATGTCCAGGGTGGGTATGGGAGCTGGGATTCATCATTTTGTTATGAG
ATACCTGGCTGCCATAGGTTGACATGACCGAATTAGGGCCCATCATGACGTTCTGGCCCA
GAACCCGGCTGTTGGGCTGGGCTACCCCAGGATCAACTGGTGTCATAATGTCATTATGGG
GAGGAGAGTCAGAAGTCAGCAACTCCTTCAAAGAGTCCAGCGCACAGTTATACTGACTCA
TACCTNCATACCTCGACTTATTGTCCTGAAATGTTTGTATAGGCATCTGGGGGCAAGGGC
TCATGCTGNATNGGCCATATGTATATTTTTGGTAGTTTGGGCTGGGTGAATTCAAACTGG
TGTTTGTGGCGCAAACGATTACACGGCGTCTGCTGATCAATGTGCCCAGTGAGGACTGGG
CTGAACAGTTATGATTTTGTGATGACACAAGTTGAGATTTCAAAGATTTCCTGTTTCTGG
ATTGCTATTTACAAGCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002015
ORF Size 1968 bp
Insert Size 2600
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002015.2, NP_002006
RefSeq Size 5723
Locus ID 2308
Cytogenetics 13q14.11
Domains FH
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Insulin signaling pathway, Pathways in cancer, Prostate cancer
Gene Summary This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in myogenic growth and differentiation. Translocation of this gene with PAX3 has been associated with alveolar rhabdomyosarcoma. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations