GSK3 beta (GSK3B) (NM_002093) Human Untagged Clone

CAT#: SC118826

Reviews ()
Write a review

GSK3B (untagged)-Human glycogen synthase kinase 3 beta (GSK3B), transcript variant 1



  "NM_002093" in other vectors (11)

SC118826 is the updated version of SC118824.

USD 730.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name GSK3 beta (GSK3B) (NM_002093) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol GSK3B
Synonyms glycogen synthase kinase-3 beta; glycogen synthase kinase 3 beta; GSK3beta isoform
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC118826 sequence for NM_002093 edited (data generated by NextGen Sequencing)
ATGTCAGGGCGGCCCAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCGGTGCAGCAGCCT
TCAGCTTTTGGCAGCATGAAAGTTAGCAGAGACAAGGACGGCAGCAAGGTGACAACAGTG
GTGGCAACTCCTGGGCAGGGTCCAGACAGGCCACAAGAAGTCAGCTATACAGACACTAAA
GTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCAGGAGAA
CTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATC
ATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGT
GAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATAC
AGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTG
TATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGG
GATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGAC
TTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCGTATATCTGTTCTCGG
TACTATAGGGCACCAGAGTTGATCTTTGGAGCCACTGATTATACCTCTAGTATAGATGTA
TGGTCTGCTGGCTGTGTGTTGGCTGAGCTGTTACTAGGACAACCAATATTTCCAGGGGAT
AGTGGTGTGGATCAGTTGGTAGAAATAATCAAGGTCCTGGGAACTCCAACAAGGGAGCAA
ATCAGAGAAATGAACCCAAACTACACAGAATTTAAATTCCCTCAAATTAAGGCACATCCT
TGGACTAAGGATTCGTCAGGAACAGGACATTTCACCTCAGGAGTGCGGGTCTTCCGACCC
CGAACTCCACCGGAGGCAATTGCACTGTGTAGCCGTCTGCTGGAGTATACACCAACTGCC
CGACTAACACCACTGGAAGCTTGTGCACATTCATTTTTTGATGAATTACGGGACCCAAAT
GTCAAACTACCAAATGGGCGAGACACACCTGCACTCTTCAACTTCACCACTCAAGAACTG
TCAAGTAATCCACCTCTGGCTACCATCCTTATTCCTCCTCATGCTCGGATTCAAGCAGCT
GCTTCAACCCCCACAAATGCCACAGCAGCGTCAGATGCTAATACTGGAGACCGTGGACAG
ACCAATAATGCTGCTTCTGCATCAGCTTCCAACTCCACCTGA

Clone variation with respect to NM_002093.3
>OriGene 5' read for NM_002093 unedited
CTCACTATAGGCGGCCGCGAATTCGCACGAGGCCTTTCTCTTCAGCGTGAGACTCGTGAT
CCTTCCGCCGCTTCCCTTTCTTCATTGACTCGGAAAAAAAATCCCCGAGGAAAATATAAT
ATTCGAAGTACTCATTTTCAATCAAGTATTTGCCCCCGTTTCACGTGATACATATTTTTT
TAGGATTTGCCCTCTCTTTTCTCTCCTCCCAGGAAAGGGAGGGGAAAGAATTGTATTTTT
TCCCAAGTCCTAAATCATCTATATGTTAAATATCCGTGCCGATCTGTCTTGAAGGAGAAA
TATATCGCTTGTTTTGTTTTTTATAGTATACAAAAGGAGTGAAAAGCCAAGAGGACGAAG
TCTTTTTCTTTTTCTTCTGTGGGAGAACTTAATGCTGCATTTATCGTTAACCTAACACCC
CAACATAAAGACAAAAGGAAGAAAAGGAGGAAGGAAGGAAAAGGTGATTCGCGAAGAGAG
TGATCATGTCAGGGCGGCCCAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCGGTGCAGC
AGCCTTCAGCTTTTGGCAGCATGAAAGTTAGCAGAGACAAGGACGGCAGCAAGGTGACAA
CAGTGGTGGCAACTCCTGNGCAGGGTCCAGACAGGCCACAAGAAGTCAGCTATACAGACA
CTAAAGTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCAG
GAGAACTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGATCGAGAGCTCCA
GATCATGAGAAAGCTAGATCACTGGTACATAGTCCGATTTGCGTATTTCTTCTACTNCAG
TGTGAGAAGAAAGAGAGGTCTATCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002093
Insert Size 7800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002093.2, NP_002084.2
RefSeq Size 1639 bp
RefSeq ORF 1302 bp
Locus ID 2932
Cytogenetics 3q13.33
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Alzheimer's disease, Axon guidance, Basal cell carcinoma, B cell receptor signaling pathway, Cell cycle, Chemokine signaling pathway, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Focal adhesion, Hedgehog signaling pathway, Insulin signaling pathway, Melanogenesis, Neurotrophin signaling pathway, Pathways in cancer, Prostate cancer, T cell receptor signaling pathway, Wnt signaling pathway
Gene Summary The protein encoded by this gene is a serine-threonine kinase belonging to the glycogen synthase kinase subfamily. It is a negative regulator of glucose homeostasis and is involved in energy metabolism, inflammation, ER-stress, mitochondrial dysfunction, and apoptotic pathways. Defects in this gene have been associated with Parkinson disease and Alzheimer disease. [provided by RefSeq, Aug 2017]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Citations (1)

Other Versions

Other products for "GSK3B"
Frequently bought together (2)
Mouse Monoclonal GSK-3 beta Antibody (3D10)
    • 100 ul

USD 430.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools