Glutathione Peroxidase 4(GPX4) (NM_002085) Human Untagged Clone

CAT#: SC118821

GPX4 (untagged)-Human glutathione peroxidase 4 (phospholipid hydroperoxidase) (GPX4), transcript variant 1 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Glutathione Peroxidase 4(GPX4) (NM_002085) Human Untagged Clone
Symbol GPX4
Synonyms GPx-4; GSHPx-4; MCSP; PHGPx; snGPx; snPHGPx
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_002085, the custom clone sequence may differ by one or more nucleotides


ATGAGCCTCGGCCGCCTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCC
TGGCCGGGACCATGTGCGCGTCCCGGGACGACTGGCGCTGTGCGCGCTCCATGCACGAGTTTTCCGCCAA
GGACATCGACGGGCACATGGTTAACCTGGACAAGTACCGGGGCTTCGTGTGCATCGTCACCAACGTGGCC
TCCCAGTGAGGCAAGACCGAAGTAAACTACACTCAGCTCGTCGACCTGCACGCCCGATACGCTGAGTGTG
GTTTGCGGATCCTGGCCTTCCCGTGTAACCAGTTCGGGAAGCAGGAGCCAGGGAGTAACGAAGAGATCAA
AGAGTTCGCCGCGGGCTACAACGTCAAATTCGATATGTTCAGCAAGATCTGCGTGAACGGGGACGACGCC
CACCCGCTGTGGAAGTGGATGAAGATCCAACCCAAGGGCAAGGGCATCCTGGGAAATGCCATCAAGTGGA
ACTTCACCAAGTTCCTCATCGACAAGAACGGCTGCGTGGTGAAGCGCTACGGACCCATGGAGGAGCCCCT
GGTGATAGAGAAGGACCTGCCCCACTATTTCTAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_002085 unedited
CCCCCGATAGGATTTGTATACGACTTATATAGGCGGCCGCGCAATTCGCACGAGGGTGGG
GGAGCCAGGAGGGGCGGGCGACGGGCGGGTATGGGCCGCGCGGGCGCAGGCTCCCCCGGG
CGCCGCAGGCAGCGGTGCCAGAGCCGGGGCAGGCGGCGGCCGCGAGCCCCTCGGCGGCGG
AAGGCCCCAGCGTGCAGGCGCAGGAGGGCGCGGCGCCGGCGGAAGAAGCCCTGTCCCCGC
AGCTTGCGACCGGAGATCCACGAATGTCCCAAGTCCCAGGACCCGTGCGCGTCCCGGGAC
GACTGGCGCTGTGCGCGCTCCATGCACGAGTTTTCCGCCAAGGACATCGACGGGCACATG
GTTAACCTGGACAAGTACCGGGGCTTCGTGTGCATCGTCACCAACGTGGCCTCCCAGTGA
GGCAAGACCGAAGTAAACTACACTCAGCTCGTCGACCTGCACGCCCGATACGCTGAGTGT
GGTTTGCGGATCCTGGCCTTCCCGTGTAACCAGTTCGGGAAGCAGGAGCCAGGGAGTAAC
GAAGAGATCAAAGAGTTCGCCGCGGGCTACAACGTCAAATTCGATATGTTCAGCAAGATC
TGCGTGAACGGGGACGACGCCCACCCGCTGTGGAAGTGGATGAAGATCCAACCCAAGGGC
AAGGGCATCCTGTGAAATGCCATCAAGTGGAACTTCACCAAGTTCCTCATCGACAAGACG
GCTGCGTGGTGAAGCGCTACTGACCCATGGAGGAGCCCCTGGTGATAGAGAAGGACCTGC
CCCACTATTTCTAGCTCCACAAGTGTGTGGCCCCGCCCGAGCCCCTGCCCACGCTCTTGG
AGCCTTTCACCGGCACTCATGACGGCCTGCCTGCCAACCTGCTGGTGGGGCAGACCCGA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002085 unedited
TTTATTCCCACAAGTAGCCAGGGGTGGGGGCGCCGAGCCAAGCCCAGCAGGCCATGGGAC
CTTCCTCCGGCGGGGTGCACGCTGGATTTTCGGGTCTGCCCCACCAGCAGGTTTGCAGGC
AGGCCGTCATGAGTGCCGGTGGAAGGCTCCAAGGGCGTGGGCAGGGGCTCGGGCGGGGCC
ACACACTTGTGGAGCTAGAAATAGTGGGGCAGGTCCTTCTCTATCACCAGGGGCTCCTCC
ATGGGTCCGTAGCGCTTCACCACGCAGCCGTTCTTGTCGATGAGGAACTTGGTGAAGTTC
CACTTGATGGCATTTCCCAGGATGCCCTTGCCCTTGGGTTGGATCTTCATCCACTTCCAC
AGCGGGTGGGCGTCGTCCCCGTTCACGCAGATCTTGCTGAACATATCGAATTTGACGTTG
TAGCCCGCGGCGAACTCTTTGATCTCTTCGTTACTCCCTGGCTCCTGCTTCCCGAACTGG
TTACACGGGAAGGCCAGGATCCGCAAACCACACTCAGCGTATCGGGCGTGCAGGTCGACG
AGCTGAGTGTAGTTTACTTCGGTCTTGCCTCACTGGGAGGCCACGTTGGTGACGATGCAC
ACGAAGCCCCGGTACTTGTCCAGGTTAACCATGTGCCCGTCGATGTCCTTGGCGGAAACT
CGTGCATGGAGCGCGCACAGCGCCAGTCGTCCTGGGACGCGCACGGNTCCTGNGACTTGG
GACATCCGGGNATCTCCGGTCGCAAGCTGCGGTGACAGGGCTTNTTCCGCCGGCGCCGNG
CCCTTCTGNNGCTGCACGCTGGGGCCCTTCCGCCGCCGAGGGGCTCGCGGCCGNCGNCTG
CCCCGCTCTGGCACGNTGNCTGCNGCGCCCGGGGNNAGCTGCGCCGGGCGGCCATACCCG
CCGTGTTCGCCCCTCTGGGTCCCCACCCTNGTGCCGATNCGGGCCGCCTTATGGAGCGTT
ATACAAATTTGACGGTCCTAACGAGCTTTGCTTATTGACTCCCACGTTACCCTACCGNCA
TTGCTG
Restriction Sites ECoRI-NOT     
Tag Tag Free
ACCN NM_002085
ORF Size 936 bp
Insert Size 1000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002085.1, NP_002076
RefSeq Size 942
RefSeq ORF 936
Locus ID 2879
Cytogenetics 19p13.3
Protein Families Druggable Genome
Protein Pathways Glutathione metabolism, Arachidonic acid metabolism
Gene Summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Mutations in this gene are associated with Sedaghatian type of spondylometaphyseal dysplasia (SMDS). This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (1) represents the shortest transcript and encodes the shortest isoform (A). A similar transcript in rat generates long and short forms of the encoded protein through alternative transcription initiation sites, the long form contains a mitochondrial transit peptide and localizes to the mitochondrion. The rat short form lacks a mitochondrial transit peptide and is present in the cytoplasm.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.