Glutathione Peroxidase 3(GPX3) (NM_002084) Human Untagged Clone

CAT#: SC118819

GPX3 (untagged)-Human glutathione peroxidase 3 (plasma) (GPX3) (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Glutathione Peroxidase 3(GPX3) (NM_002084) Human Untagged Clone
Symbol GPX3
Synonyms GPx-P; GSHPx-3; GSHPx-P
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118819 sequence for NM_002084 edited (data generated by NextGen Sequencing)
ATGGCCCGGCTGCTGCAGGCGTCCTGCCTGCTTTCCCTGCTCCTGGCCGGCTTCGTCTCG
CAGAGCCGGGGACAAGAGAAGTCGAAGATGGACTGCCATGGTGGCATAAGTGGCACCATT
TACGAGTACGGAGCCCTCACCATTGATGGGGAGGAGTACATCCCCTTCAAGCAGTATGCT
GGCAAATACGTCCTCTTTGTCAACGTGGCCAGCTACTGAGGCCTGACGGGCCAGTACATT
GAACTGAATGCACTACAGGAAGAGCTTGCACCATTCGGTCTGGTCATTCTGGGCTTTCCC
TGCAACCAATTTGGAAAACAGGAACCAGGAGAGAACTCAGAGATCCTTCCTACCCTCAAG
TATGTCCGACCAGGTGGAGGCTTTGTCCCTAATTTCCAGCTCTTTGAGAAAGGGGATGTC
AATGGAGAGAAAGAGCAGAAATTCTACACTTTCCTAAAGAACTCCTGTCCTCCCACCTCG
GAGCTCCTGGGTACATCTGACCGCCTCTTCTGGGAACCCATGAAGGTTCACGACATCCGC
TGGAACTTTGAGAAGTTCCTGGTGGGGCCAGATGGTATACCCATCATGCGCTGGCACCAC
CGGACCACGGTCAGCAACGTCAAGATGGACATCCTGTCCTACATGAGGCGGCAGGCAGCC
CTGGGGGTCAAGAGGAAGTAA

Clone variation with respect to NM_002084.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002084 unedited
TGCGTCGAGATTTGTAAACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGCCTCGTG
CCCGAATTCGCACGAGGGGGATCAGGCAGCGGCTCAGGCGACCCTGAGTGTGCCCCCACC
CCGCCATGGCCCGGCTGCTGCAGGCGTCCTGCCTGCTTTCCCTGCTCCTGGCCGGCTTCG
TCTCGCAGAGCCGGGGACAAGAGAAGTCGAAGATGGACTGCCATGGTGGCATAAGTGGCA
CCATTTACGAGTACGGAGCCCTCACCATTGATGGGGAGGAGTACATCCCCTTCAAGCAGT
ATGCTGGCAAATACGTCCTCTTTGTCAACGTGGCCAGCTACTGAGGCCTGACGGGCCAGT
ACATTGAACTGAATGCACTACAGGAAGAGCTTGCACCATTCGGTCTGGTCATTCTGGGCT
TTCCCTGCAACCAATTTGGAAAACAGGAACCAGGAGAGAACTCAGAGATCCTTCCTACCC
TCAAGTATGTCCGACCAGGTGGAGGCTTTGTCCCTAATTTCCAGCTCTTTGAGAAAGGGG
ATGTCAATGGAGAGAAAGAGCAGAAATTCTACACTTTCCTAAAGAACTCCTGTCCTCCCA
CCTCGGAGCTCCCTGGTACATCTGACCGCCTCTTCTGGGAACCCATGAAGGTCACGACAT
CCGCTGGAACTTTGAGAAGTTCCTGGTGGGGCCAGATGGTATACCCATCATGCGCTGGCA
CCCACGGACCACGGTCAGCAACGTCAAGATGGACATCCCTGTCTACATGAGGCGGCCAGC
AGCCCTGGGGGTCAAAGAGAAGTAAACTGAGGCCGTCTCATCCCATGTCCCACATGTAGG
GGAGGAACTTTTGTTCAGGAAGAAATCCGTGTCTTCCACACACTATCTACCCATCACAGA
CCCCTTTCCTATCACTCAGG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002084 unedited
NNNTTTTAGCTATGGACCGGCGGCCGCAATCTAGNGTCGAGTTTTTTTTTTTTTTTTTTT
TTTTGCTGCAGAAAGGCTTTTACTGGGCAGACGGGGTGAGTCTCAAGCCAGTGGACCAGT
GAGGGGTGAGGGCACGTCCTCCGAAGGAGCAGGGGTGGCATCCCTGCCCAGGGGCCTTAG
CCTGAATGCACTAAGGGCTGGCCCCTCAGACAGGCTCAGGGGAGGTCCGCCCACAAGGGC
TTTGGGCCCCTCCCTCATGAAGACGCCACCCCTGCCATGGGGTCCGTGGCCCTTGCTGTC
ACATCTGCCTTGGTTGATCTCAGGGAGGTTGATCTCTCTCAGGGAGAACTGTGGGGTGGG
GATGTAGCCTTGGGAGGGCCCTTCAGGAAGTAAGAGTGGGGGGTTGGGGAGTGTTNGTAN
ACCCANAAACTTCTGGGGACGTCAGTCATAGTTACTAATATTTGGAGGCAGTGGGAGATG
CTGGCCCCAAGGTTGAGGTATCAGTTAGAGCAGAACAATTGGACCTAGAGCTGGTTTTTC
CTTTGGGTTTAGGTGTAAGTGAACTATTATCATTGGAGTGGAGAACTGGAGAGAAAGGGT
TGTCACTGTCCAGCACTACACAGCTGCAGGCACACAGATGGTACACCATTCCAGAAAGAC
ACATAGGCTGACATGTACTTGGNCACNNATGCNNACACACNCAATNANGCATACCTGGAG
GCATGNGGGNAAACACCACATGCACCCACACCCCATGCCTGGCAGTACAAGAACTGTTGC
ATTCATTTGTGCCAGGCTGGGCCCTGACAGAAGGAAAGGGGCTGTGTTGTTACACCCCCT
GTCTGCAAACCCTCCTTTCTTAAAAAATCCTCCCCTCTGGGGCATCGCAGAACGGCTTAT
TCCTTCCTCCAACCCCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002084
ORF Size 1779 bp
Insert Size 1660
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002084.2, NP_002075
RefSeq Size 1856
Locus ID 2878
Cytogenetics 5q33.1
Protein Families Secreted Protein, Druggable Genome
Protein Pathways Glutathione metabolism, Arachidonic acid metabolism
Gene Summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is secreted, and is abundantly found in plasma. Downregulation of expression of this gene by promoter hypermethylation has been observed in a wide spectrum of human malignancies, including thyroid cancer, hepatocellular carcinoma and chronic myeloid leukemia. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016].
Transcript Variant: This variant (1) represents the predominant transcript and encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.