JAK1 (NM_002227) Human Untagged Clone

CAT#: SC118761

JAK1 (untagged)-Human Janus kinase 1 (JAK1)

USD 1,041


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name JAK1 (NM_002227) Human Untagged Clone
Symbol JAK1
Synonyms JAK1A; JAK1B; JTK3
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_002227 edited
ATGCAGTATCTAAATATAAAAGAGGACTGCAATGCCATGGCTTTCTGTGCTAAAATGAGG
AGCTCCAAGAAGACTGAGGTGAACCTGGAGGCCCCTGAGCCAGGGGTGGAAGTGATCTTC
TATCTGTCGGACAGGGAGCCCCTCCGGCTGGGCAGTGGAGAGTACACAGCAGAGGAACTG
TGCATCAGGGCTGCACAGGCATGCCGTATCTCTCCTCTTTGTCACAACCTCTTTGCCCTG
TATGACGAGAACACCAAGCTCTGGTATGCTCCAAATCGCACCATCACCGTTGATGACAAG
ATGTCCCTCCGGCTCCACTACCGGATGAGGTTCTATTTCACCAATTGGCATGGAACCAAC
GACAATGAGCAGTCAGTGTGGCGTCATTCTCCAAAGAAGCAGAAAAATGGCTACGAGAAA
AAAAAGATTCCAGATGCAACCCCTCTCCTTGATGCCAGCTCACTGGAGTATCTGTTTGCT
CAGGGACAGTATGATTTGGTGAAATGCCTGGCTCCTATTCGAGACCCCAAGACCGAGCAG
GATGGACATGATATTGAGAACGAGTGTCTAGGGATGGCTGTCCTGGCCATCTCACACTAT
GCCATGATGAAGAAGATGCAGTTGCCAGAACTGCCCAAGGACATCAGCTACAAGCGATAT
ATTCCAGAAACATTGAATAAGTCCATCAGACAGAGGAACCTTCTCACCAGGATGCGGATA
AATAATGTTTTCAAGGATTTCCTAAAGGAATTTAACAACAAGACCATTTGTGACAGCAGC
GTGTCCACGCATGACCTGAAGGTGAAATACTTGGCTACCTTGGAAACTTTGACAAAACAT
TACGGTGCTGAAATATTTGAGACTTCCATGTTACTGATTTCATCAGAAAATGAGATGAAT
TGGTTTCATTCGAATGACGGTGGAAACGTTCTCTACTACGAAGTGATGGTGACTGGGAAT
CTTGGAATCCAGTGGAGGCATAAACCAAATGTTGTTTCTGTTGAAAAGGAAAAAAATAAA
CTGAAGCGGAAAAAACTGGAAAATAAACACAAGAAGGATGAGGAGAAAAACAAGATCCGG
GAAGAGTGGAACAATTTTTCTTACTTCCCTGAAATCACTCACATTGTAATAAAGGAGTCT
GTGGTCAGCATTAACAAGCAGGACAACAAGAAAATGGAACTGAAGCTCTCTTCCCACGAG
GAGGCCTTGTCCTTTGTGTCCCTGGTAGATGGCTACTTCCGGCTCACAGCAGATGCCCAT
CATTACCTCTGCACCGACGTGGCCCCCCCGTTGATCGTCCACAACATACAGAATGGCTGT
CATGGTCCAATCTGTACAGAATACGCCATCAATAAATTGCGGCAAGAAGGAAGCGAGGAG
GGGATGTACGTGCTGAGGTGGAGCTGCACCGACTTTGACAACATCCTCATGACCGTCACC
TGCTTTGAGAAGTCTGAGCAGGTGCAGGGTGCCCAGAAGCAGTTCAAGAACTTTCAGATC
GAGGTGCAGAAGGGCCGCTACAGTCTGCACGGTTCGGACCGCAGCTTCCCCAGCTTGGGA
GACCTCATGAGCCACCTCAAGAAGCAGATCCTGCGCACGGATAACATCAGCTTCATGCTA
AAACGCTGCTGCCAGCCCAAGCCCCGAGAAATCTCCAACCTGCTGGTGGCTACTAAGAAA
GCCCAGGAGTGGCAGCCCGTCTACCCCATGAGCCAGCTGAGTTTCGATCGGATCCTCAAG
AAGGATCTGGTGCAGGGCGAGCACCTTGGGAGAGGCACGAGAACACACATCTATTCTGGG
ACCCTGATGGATTACAAGGATGACGAAGGAACTTCTGAAGAGAAGAAGATAAAAGTGATC
CTCAAAGTCTTAGACCCCAGCCACAGGGATATTTCCCTGGCCTTCTTCGAGGCAGCCAGC
ATGATGAGACAGGTCTCCCACAAACACATCGTGTACCTCTATGGCGTCTGTGTCCGCGAC
GTGGAGAATATCATGGTGGAAGAGTTTGTGGAAGGGGGTCCTCTGGATCTCTTCATGCAC
CGGAAAAGCGATGTCCTTACCACACCATGGAAATTCAAAGTTGCCAAACAGCTGGCCAGT
GCCCTGAGCTACTTGGAGGATAAAGACCTGGTCCATGGAAATGTGTGTACTAAAAACCTC
CTCCTGGCCCGTGAGGGCATCGACAGTGAGTGTGGCCCATTCATCAAGCTCAGTGACCCC
GGCATCCCCATTACGGTGCTGTCTAGGCAAGAATGCATTGAACGAATCCCATGGATTGCT
CCTGAGTGTGTTGAGGACTCCAAGAACCTGAGTGTGGCTGCTGACAAGTGGAGCTTTGGA
ACCACGCTCTGGGAAATCTGCTACAATGGCGAGATCCCCTTGAAAGACAAGACGCTGATT
GAGAAAGAGAGATTCTATGAAAGCCGGTGCAGGCCAGTGACACCATCATGTAAGGAGCTG
GCTGACCTCATGACCCGCTGCATGAACTATGACCCCAATCAGAGGCCTTTCTTCCGAGCC
ATCATGAGAGACATTAATAAGCTTGAAGAGCAGAATCCAGATATTGTTTCAGAAAAAAAA
CCAGCAACTGAAGTGGACCCCACACATTTTGAAAAGCGCTTCCTAAAGAGGATCCGTGAC
TTGGGAGAGGGCCACTTTGGGAAGGTTGAGCTCTGCAGGTATGACCCCGAAGGGGACAAT
ACAGGGGAGCAGGTGGCTGTTAAATCTCTGAAGCCTGAGAGTGGAGGTAACCACATAGCT
GATCTGAAAAAGGAAATCGAGATCTTAAGGAACCTCTATCATGAGAACATTGTGAAGTAC
AAAGGAATCTGCACAGAAGACGGAGGAAATGGTATTAAGCTCATCATGGAATTTCTGCCT
TCGGGAAGCCTTAAGGAATATCTTCCAAAGAATAAGAACAAAATAAACCTCAAACAGCAG
CTAAAATATGCCGTTCAGATTTGTAAGGGGATGGACTATTTGGGTTCTCGGCAATACGTT
CACCGGGACTTGGCAGCAAGAAATGTCCTTGTTGAGAGTGAACACCAAGTGAAAATTGGA
GACTTCGGTTTAACCAAAGCAATTGAAACCGATAAGGAGTATTACACCGTCAAGGATGAC
CGGGACAGCCCTGTGTTTTGGTATGCTCCAGAATGTTTAATGCAATCTAAATTTTATATT
GCCTCTGACGTCTGGTCTTTTGGAGTCACTCTGCATGAGCTGCTGACTTACTGTGATTCA
GATTCTAGTCCCATGGCTTTGTTCCTGAAAATGATAGGCCCAACCCATGGCCAGATGACA
GTCACAAGACTTGTGAATACGTTAAAAGAAGGAAAACGCCTGCCGTGCCCACCTAACTGT
CCAGATGAGGTTTATCAACTTATGAGGAAATGCTGGGAATTCCAACCATCCAATCGGACA
AGCTTTCAGAACCTTATTGAAGGATTTGAAGCACTTTTAAAATAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002227 unedited
NAAGGGTTCAGAATTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGCCTGG
CCCAGGCGCACACGGNAGTGCGCTTCTCTGAAGTAGCTTTGGAAAGTAGAGAAGAAAATC
CAGTTTGCTTCTTGGAGAACACTGGACAGCTGAATAAATGCAGTATCTAAATATAAAAGA
GGACTGCAATGCCATGGCTTTCTGTGCTAAAATGAGGAGCTCCAAGAAGACTGAGGTGAA
CCTGGAGGCCCCTGAGCCAGGGGTGGAAGTGATCTTCTATCTGTCGGACAGGGAGCCCCT
CCGGCTGGGCAGTGGAGAGTACACAGCAGAGGAACTGTGCATCAGGGCTGCACAGGCATG
CCGTATCTCTCCTCTTTGTCACAACCTCTTTGCCCTGTATGACGAGAACACCAAGCTCTG
GTATGCTCCAAATCGCACCATCACCGTTGATGACAAGATGTCCCTCCGGCTCCACTACCG
GATGAGGTTCTATTTCACCAATTGGCATGGAACCAACGACAATGAGCAGTCAGTGTGGCG
TCATTCTCCAAAGAAGCAGAAAAATGGCTACGAGAAAAAAAAGATTCCAGATGCAACCCC
TCTCCTTGATGCCAGCTCACTGGAGTATCTGTTTGCTCAGGGACAGTATGATTTGGTGAA
ATGCCTGGCTCCTATTCGAGACCCCAAGACCGAGCAGGATGGACATGATATTGAGAACGA
GTGTCTAGGGATGGCTGTCCTGGCCATCTCACACTATGCCATGATGAAAAAGATGCAGTT
GCCAGAACTGCCCAAGGACATCAGCTACAAGCGATATATTCCAGAACATTGAATAAGTCC
ATCAGACAGAGGAACCTTCTCACCNAGATGCGGATAAATAATGGTTTTCAAGGATTTTCC
TAAGGAATTTAACACC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002227 unedited
NNTTTTTTTTGGGTATTATCTATGNNACCGCGGCCGCATNCTANNGATCGATTTTTTTTT
TTTTTTTTTTTTTTTTTTTAAAATCTTTAGTATATTTATTTGTATAAAGAGTAAACAAAG
TGCATATAGAGTGGCCACAGGTTTGACACAGAGACCTTGGTGATGTAGGCTATGAACAAA
TTTAAATGGCAACTTCATTGCTGCCACTGAACCAATCCTGAATTTGGGCTCAACAGGTGA
AAAGTAACAATATCAAACGAATACTAAACAGCATAACAAAAAGATTTTCAGACTCTTGGT
CATAAAGACCGTAATCGTTCACATTGAATCAATGACTAAACATTTTTGATTACCCAGCTA
CCTCCAAGCAAACTGAAAACTGTCTAGTGGATCCTGAAGTCCATAGTGCCTCTAGCCGGG
TCTTTCAAGTGTTGCACCACAGGGTGATGATTGATGGTAAAAACAAGGATCAACCCTTGT
AGATCGGTGGTTAAGTATGAAACCCTCTAAGAACGTGCAGCGTATGTGGTATTCAAACTG
GGTGCATACAGCATTCAAAACCAGTGCTGGAATAACTTGGCCAAAAATGGGTGAAGTTAT
AAAAAGATATACCTTGCCCTTTCTTAAAAGCATGTGGTATAACCTTCAAGGTTCTGGGAA
GGAATTCTTGATTAAAAGGATTACTGCTTAAGAAAAACACTGGGCCAAAGCTTTAGTTTT
TTGGGAATTTAAATGCCCCAAAATTATCTATTTCCCAAACTTTTCCCCCCTGGGTAAAAC
AAGCTTTTCTTAAAAAAGGGTGGCTAGTGGATCCCCCAAGGNACAGGAGCTAAACCACTG
ANAGAACAAAGTTTAAGTCTACTGGTGAGAGATACAGTCATTTTTGTACAGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002227
ORF Size 3429 bp
Insert Size 5100
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002227.1, NP_002218
RefSeq Size 3541
RefSeq ORF 3429
Locus ID 3716
Cytogenetics 1p31.3
Domains pkinase, SH2
Protein Families Protein Kinase, Druggable Genome
Protein Pathways Jak-STAT signaling pathway, Pathways in cancer, Pancreatic cancer
Gene Summary This gene encodes a membrane protein that is a member of a class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The encoded kinase phosphorylates STAT proteins (signal transducers and activators of transcription) and plays a key role in interferon-alpha/beta and interferon-gamma signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations