LRP5(LRP5) (NM_002335) Human Untagged Clone

CAT#: SC118678

LRP5 (untagged)-Human low density lipoprotein receptor-related protein 5 (LRP5)

USD 1,041.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name LRP5(LRP5) (NM_002335) Human Untagged Clone
Symbol LRP5
Synonyms BMND1; EVR1; EVR4; HBM; LR3; LRP-5; LRP7; OPPG; OPS; OPTA1; VBCH2
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118678 sequence for NM_002335 edited (data generated by NextGen Sequencing)
ATGGAGGCAGCGCCGCCCGGGCCGCCGTGGCCGCTGCTGCTGCTGCTGCTGCTGCTGCTG
GCGCTGTGCGGCTGCCCGGCCCCCGCCGCGGCCTCGCCGCTCCTGCTATTTGCCAACCGC
CGGGACGTACGGCTGGTGGACGCCGGCGGAGTCAAGCTGGAGTCCACCATCGTGGTCAGC
GGCCTGGAGGATGCGGCCGCAGTGGACTTCCAGTTTTCCAAGGGAGCCGTGTACTGGACA
GACGTGAGCGAGGAGGCCATCAAGCAGACCTACCTGAACCAGACGGGGGCCGCCGTGCAG
AACGTGGTCATCTCCGGCCTGGTCTCTCCCGACGGCCTCGCCTGCGACTGGGTGGGCAAG
AAGCTGTACTGGACGGACTCAGAGACCAACCGCATCGAGGTGGCCAACCTCAATGGCACA
TCCCGGAAGGTGCTCTTCTGGCAGGACCTTGACCAGCCGAGGGCCATCGCCTTGGACCCC
GCTCACGGGTACATGTACTGGACAGACTGGGGTGAGACGCCCCGGATTGAGCGGGCAGGG
ATGGATGGCAGCACCCGGAAGATCATTGTGGACTCGGACATTTACTGGCCCAATGGACTG
ACCATCGACCTGGAGGAGCAGAAGCTCTACTGGGCTGACGCCAAGCTCAGCTTCATCCAC
CGTGCCAACCTGGACGGCTCGTTCCGGCAGAAGGTGGTGGAGGGCAGCCTGACGCACCCC
TTCGCCCTGACGCTCTCCGGGGACACTCTGTACTGGACAGACTGGCAGACCCGCTCCATC
CATGCCTGCAACAAGCGCACTGGGGGGAAGAGGAAGGAGATCCTGAGTGCCCTCTACTCA
CCCATGGACATCCAGGTGCTGAGCCAGGAGCGGCAGCCTTTCTTCCACACTCGCTGTGAG
GAGGACAATGGCGGCTGCTCCCACCTGTGCCTGCTGTCCCCAAGCGAGCCTTTCTACACA
TGCGCCTGCCCCACGGGTGTGCAGCTGCAGGACAACGGCAGGACGTGTAAGGCAGGAGCC
GAGGAGGTGCTGCTGCTGGCCCGGCGGACGGACCTACGGAGGATCTCGCTGGACACGCCG
GACTTCACCGACATCGTGCTGCAGGTGGACGACATCCGGCACGCCATTGCCATCGACTAC
GACCCGCTAGAGGGCTATGTCTACTGGACAGATGACGAGGTGCGGGCCATCCGCAGGGCG
TACCTGGACGGGTCTGGGGCGCAGACGCTGGTCAACACCGAGATCAACGACCCCGATGGC
ATCGCGGTCGACTGGGTGGCCCGAAACCTCTACTGGACCGACACGGGCACGGACCGCATC
GAGGTGACGCGCCTCAACGGCACCTCCCGCAAGATCCTGGTGTCGGAGGACCTGGACGAG
CCCCGAGCCATCGCACTGCACCCCGTGATGGGCCTCATGTACTGGACAGACTGGGGAGAG
AACCCTAAAATCGAGTGTGCCAACTTGGATGGGCAGGAGCGGCGTGTGCTGGTCAATGCC
TCCCTCGGGTGGCCCAACGGCCTGGCCCTGGACCTGCAGGAGGGGAAGCTCTACTGGGGA
GACGCCAAGACAGACAAGATCGAGGTGATCAATGTTGATGGGACGAAGAGGCGGACCCTC
CTGGAGGACAAGCTCCCGCACATTTTCGGGTTCACGCTGCTGGGGGACTTCATCTACTGG
ACTGACTGGCAGCGCCGCAGCATCGAGCGGGTGCACAAGGTCAAGGCCAGCCGGGACGTC
ATCATTGACCAGCTGCCCGACCTGATGGGGCTCAAAGCTGTGAATGTGGCCAAGGTCGTC
GGAACCAACCCGTGTGCGGACAGGAACGGGGGGTGCAGCCACCTGTGCTTCTTCACACCC
CACGCAACCCGGTGTGGCTGCCCCATCGGCCTGGAGCTGCTGAGTGACATGAAGACCTGC
ATCGTGCCTGAGGCCTTCTTGGTCTTCACCAGCAGAGCCGCCATCCACAGGATCTCCCTC
GAGACCAATAACAACGACATGGCCATCCCGCTCACGGGCGTCAAGGAGGCCTCAGCCCTG
GACTTTGATGTGTCCAACAACCACATCTACTGGACAGACGTCAGCCTGAAGACCATCAGC
CGCGCCTTCATGAACGGGAGCTCGGTGGAGCACGTGGTGGAGTTTGGCCTTGACTACCCC
GAGGGCATGGCCGTTGACTGGATGGGCAAGAACCTCTACTGGGCCGACACTGGGACCAAT
AGAATCGAAGTGGCGCGGCTGGACGGGCAGTTCCGGCAAGTCCTCGTGTGGAGGGACTTG
GACAACCCGAGGTCGCTGGCCCTGGATCCCACCAAGGGCTACATCTACTGGACCGAGTGG
GGCGGCAAGCCGAGGATCGTGCGGGCCTTCATGGACGGGACCAACTGCATGACGCTGGTG
GACAAGGTGGGCCGGGCCAACGACCTCACCATTGACTACGCTGACCAGCGCCTCTACTGG
ACCGACCTGGACACCAACATGATCGAGTCGTCCAACATGCTGGGTCAGGAGCGGGTCGTG
ATTGCCGACGATCTCCCGCACCCGTTCGGTCTGACGCAGTACAGCGATTATATCTACTGG
ACAGACTGGAATCTGCACAGCATTGAGCGGGCCGACAAGACTAGCGGCCGGAACCGCACC
CTCATCCAGGGCCACCTGGACTTCGTGATGGACATCCTGGTGTTCCACTCCTCCCGCCAG
GATGGCCTCAATGACTGTATGCACAACAACGGGCAGTGTGGGCAGCTGTGCCTTGCCATC
CCCGGCGGCCACCGCTGCGGCTGCGCCTCACACTACACCCTGGACCCCAGCAGCCGCAAC
TGCAGCCCGCCCACCACCTTCTTGCTGTTCAGCCAGAAATCTGCCATCAGTCGGATGATC
CCGGACGACCAGCACAGCCCGGATCTCATCCTGCCCCTGCATGGACTGAGGAACGTCAAA
GCCATCGACTATGACCCACTGGACAAGTTCATCTACTGGGTGGATGGGCGCCAGAACATC
AAGCGAGCCAAGGACGACGGGACCCAGCCCTTTGTTTTGACCTCTCTGAGCCAAGGCCAA
AACCCAGACAGGCAGCCCCACGACCTCAGCATCGACATCTACAGCCGGACACTGTTCTGG
ACGTGCGAGGCCACCAATACCATCAACGTCCACAGGCTGAGCGGGGAAGCCATGGGGGTG
GTGCTGCGTGGGGACCGCGACAAGCCCAGGGCCATCGTCGTCAACGCGGAGCGAGGGTAC
CTGTACTTCACCAACATGCAGGACCGGGCAGCCAAGATCGAACGCGCAGCCCTGGACGGC
ACCGAGCGCGAGGTCCTCTTCACCACCGGCCTCATCCGCCCTGTGGCCCTGGTGGTGGAC
AACACACTGGGCAAGCTGTTCTGGGTGGACGCGGACCTGAAGCGCATTGAGAGCTGTGAC
CTGTCAGGGGCCAACCGCCTGACCCTGGAGGACGCCAACATCGTGCAGCCTCTGGGCCTG
ACCATCCTTGGCAAGCATCTCTACTGGATCGACCGCCAGCAGCAGATGATCGAGCGTGTG
GAGAAGACCACCGGGGACAAGCGGACTCGCATCCAGGGCCGTGTCGCCCACCTCACTGGC
ATCCATGCAGTGGAGGAAGTCAGCCTGGAGGAGTTCTCACCCCACCCATGTGCCCGTGAC
AATGGTGGCTGCTCCCACATCTGTATTGCCAAGGGTGATGGGACACCACGGTGCTCATGC
CCAGTCCACCTCGTGCTCCTGCAGAACCTGCTGACCTGTGGAGAGCCGCCCACCTGCTCC
CCGGACCAGTTTGCATGTGCCACAGGGGAGATCGACTGTATCCCCGGGGCCTGGCGCTGT
GACGGCTTTCCCGAGTGCGATGACCAGAGCGACGAGGAGGGCTGCCCCGTGTGCTCCGCC
GCCCAGTTCCCCTGCGCGCGGGGTCAGTGTGTGGACCTGCGCCTGCGCTGCGACGGCGAG
GCAGACTGTCAGGACCGCTCAGACGAGGTGGACTGTGACGCCATCTGCCTGCCCAACCAG
TTCCGGTGTGCGAGCGGCCAGTGTGTCCTCATCAAACAGCAGTGCGACTCCTTCCCCGAC
TGTATCGACGGCTCCGACGAGCTCATGTGTGAAATCACCAAGCCGCCCTCAGACGACAGC
CCGGCCCACAGCAGTGCCATCGGGCCCGTCATTGGCATCATCCTCTCTCTCTTCGTCATG
GGTGGTGTCTATTTTGTGTGCCAGCGCGTGGTGTGCCAGCGCTATGCGGGGGCCAACGGG
CCCTTCCCGCACGAGTATGTCAGCGGGACCCCGCACGTGCCCCTCAATTTCATAGCCCCG
GGCGGTTCCCAGCATGGCCCCTTCACAGGCATCGCATGCGGAAAGTCCATGATGAGCTCC
GTGAGCCTGATGGGGGGCCGGGGCGGGGTGCCCCTCTACGACCGGAACCACGTCACAGGG
GCCTCGTCCAGCAGCTCGTCCAGCACGAAGGCCACGCTGTACCCGCCGATCCTGAACCCG
CCGCCCTCCCCGGCCACGGACCCCTCCCTGTACAACATGGACATGTTCTACTCTTCAAAC
ATTCCGGCCACTGCGAGACCGTACAGGCCCTACATCATTCGAGGAATGGCGCCCCCGACG
ACGCCCTGCAGCACCGACGTGTGTGACAGCGACTACAGCGCCAGCCGCTGGAAGGCCAGC
AAGTACTACCTGGATTTGAACTCGGACTCAGACCCCTATCCACCCCCACCCACGCCCCAC
AGCCAGTACCTGTCGGCGGAGGACAGCTGCCCGCCCTCGCCCGCCACCGAGAGGAGCTAC
TTCCATCTCTTCCCGCCCCCTCCGTCCCCCTGCACGGACTCATCCTGA

Clone variation with respect to NM_002335.2
1647 t=>c;1999 g=>a;2220 c=>t;3640 g=>c;3989 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002335 unedited
TTCCCCGCCCCGTTGCCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCA
GAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGA
ATTCGGCACGAGGCCCGAGGGGGGAGGCGGAGGCGCCGGGAGCCGCGCGAGGAGCCGCCG
CCGCCGCGCCATGGAGCCCGAGTGAGCGCGGCGCGGGCCCGTCCGGCCGCCGGACAACAT
GGAGGCAGCGCCGCCCGGGCCGCCGTGGCCGCTGCTGCTGCTGCTGCTGCTGCTGCTGGC
GCTGTGCGGCTGCCCGGCCCCCGCCGCGGCCTCGCCGCTCCTGCTATTTGCCAACCGCCG
GGACGTACGGCTGGTGGACGCCGGCGGAGTCAAGCTGGAGTCCACCATCGTGGTCAGCGG
CCTGGAGGATGCGGCCGCAGTGGACTTCCAGTTTTCCAAGGGAGCCGTGTACTGGACAGA
CGTGAGCGAGGAGGCCATCAAGCAGACCTACCTGAACCAGACGGGGGCCGCCGTGCAGAA
CGTGGTCATCTCCGGCCTGGTCTCTCCCGACGGCCTCGCCTGCGACTGGGTGGGCAAGAA
GCTGTACTGGACGGACTCAGAGACCAACCGCATCGAGGTGGCCAACCTCAATGGCACATC
CCGGAAGGTGCTCTTCTGGCANGACCTTGACCAGCCGATGGCCATCGCCTTGGACCCCGC
TCACGGGTACATGTACTGGACAGACTGGNGTGAGACGCCCCGGATTGATGCGGCAGGGAT
GGATGGCAGCACCCGGAAGATCATTGTGGACTCGGACATTTACTGGCCCCATGGACTGAC
CATCGACCTGGNAGAGCAGAAGCTCTACTGGGCTGACGCCCAGCTCAGCTTCATTCACCG
TGCCACCTGGNACGCTCGTNCCGCAAAAGTGGTGGNAGGCAC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002335 unedited
NNAATCTNTGNNACCGCGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTGTTCA
TATTTAAAACTATTTACAGGGGCACAGAGAAGCCAGAGTGGCCCGGCCGAGGTCAGGATG
AGTCCGTGCAGGGGGACGGAGGGGGCGGGAAGAGATGGAAGTAGCTCCTCTCGGTGGCGG
GCGAGGGCGGGCAGCTGTCCTCCGCCGACAGGTACTGGCTGTGGGGCGTGGGTGGGGGTG
GATAGGGGTCTGAGTCCGAGTTCAAATCCAGGTAGTACTTGCTGGCCTTCCAGCGGCTGG
CGCTGTAGTCGCTGTCACACACGTCGGTGCTGCAGGGCGTCGTCGGGGGCGCCATTCCTC
GAATGATGTAGGGCCTGTACGGTCTCGCAGTGGCCGGAATGTTTGAAGAGTAGAACATGT
CCATGTTGTACAGGGAGGGGTCCGTGGCCGGGGAGGGCGGCGGGTTCAGGATCGGCGGGT
ACAGCGTGGCCTTCGTGCTGGACGAGCTGCTGGACGAGGCCCCTGTGACGTGGTTCCGGT
CGTAGAGGGGCACCCCGCCCCGGCCCCCCATCAGGCTCACGGAGCTCATCATGGACTTTC
CGCATGCGATGCCTGTGAAGGGGCCATGCTGGGAACCGCCCGGGGCTATGAAATTGAGGG
GCACGTGCGGGGTCCCGCTGACATACTCGTGCGGGAAGGGCCCGTTGGCCCCCGCATAGC
GCTGGCACACCACGCGCTGGCACACAAAATAGACACCACCCATGACGAAGAGAGAGAGGA
TGATGCCAATGACGGGCCCGATGGCACTGCTGTGGGCCGGGCTGTCGTCTGAGGGCGGCT
TGGTGATTCACACATGAGCTCGTCGGACCCGTGAACAGTCGGGGAAGGATCCACTGCTGT
TTGATGAGGACAACTGGCCGCTCGACC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002335
ORF Size 4848 bp
Insert Size 4700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002335.1, NP_002326
RefSeq Size 5100
Locus ID 4041
Cytogenetics 11q13.2
Domains ldl_recept_b, ldl_recept_a, EGF, EGF
Protein Families Transmembrane, Druggable Genome
Protein Pathways Wnt signaling pathway
Gene Summary This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations