WNT2 (NM_003391) Human Untagged Clone

CAT#: SC118000

Reviews ()
Write a review

WNT2 (untagged)-Human wingless-type MMTV integration site family member 2 (WNT2), transcript variant 1



  "NM_003391" in other vectors (6)

USD 760.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name WNT2 (NM_003391) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol WNT2
Synonyms INT1L1; IRP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_003391 edited
ATGAACGCCCCTCTCGGTGGAATCTGGCTCTGGCTCCCTCTGCTCTTGACCTGGCTCACC
CCCGAGGTCAACTCTTCATGGTGGTACATGAGAGCTACAGGTGGCTCCTCCAGGGTGATG
TGCGATAATGTGCCAGGCCTGGTGAGCAGCCAGCGGCAGCTGTGTCACCGACATCCAGAT
GTGATGCGTGCCATTAGCCAGGGCGTGGCCGAGTGGACAGCAGAATGCCAGCACCAGTTC
CGCCAGCACCGCTGGAATTGCAACACCCTGGACAGGGATCACAGCCTTTTTGGCAGGGTC
CTACTCCGAAGTAGTCGGGAATCTGCCTTTGTTTATGCCATCTCCTCAGCTGGAGTTGTA
TTTGCCATCACCAGGGCCTGTAGCCAAGGAGAAGTAAAATCCTGTTCCTGTGATCCAAAG
AAGATGGGAAGCGCCAAGGACAGCAAAGGCATTTTTGATTGGGGTGGCTGCAGTGATAAC
ATTGACTATGGGATCAAATTTGCCCGCGCATTTGTGGATGCAAAGGAAAGGAAAGGAAAG
GATGCCAGAGCCCTGATGAATCTTCACAACAACAGAGCTGGCAGGAAGGCTGTAAAGCGG
TTCTTGAAACAAGAGTGCAAGTGCCACGGGGTGAGCGGCTCATGTACTCTCAGGACATGC
TGGCTGGCCATGGCCGACTTCAGGAAAACGGGCGATTATCTCTGGAGGAAGTACAATGGG
GCCATCCAGGTGGTCATGAACCAGGATGGCACAGGTTTCACTGTGGCTAACGAGAGGTTT
AAGAAGCCAACGAAAAATGACCTCGTGTATTTTGAGAATTCTCCAGACTACTGTATCAGG
GACCGAGAGGCAGGCTCCCTGGGTACAGCAGGCCGTGTGTGCAACCTGACTTCCCGGGGC
ATGGACAGCTGTGAAGTCATGTGCTGTGGGAGAGGCTACGACACCTCCCATGTCACCCGG
ATGACCAAGTGTGGGTGTAAGTTCCACTGGTGCTGCGCCGTGCGCTGTCAGGACTGCCTG
GAAGCTCTGGATGTGCACACATGCAAGGCCCCCAAGAACGCTGACTGGACAACCGCTACA
TGA
>OriGene 5' read for NM_003391 unedited
CCCCCGAGCCACNNCCCCCCCCCCCCCCCCGGTTCAAAATTGTATACCATCACTATAGGC
GGCCGGAATCGCCCACGGATCTGACCTGAGCANCGCAGGGGGTTAATATGAACGCCCCTC
TCGGTGGAATCTGGCTCTGGCTCCCTCTGCTCTTGACCTGGCTCACCCCCGAGGTCAACT
CTTCATGGTGGTACATGAGAGCTACAGGTGGCTCCTCCAGGGTGATGTGCGATAATGTGC
CAGGCCTGGTGAGCAGCCAGCGGCAGCTGTGTCACCGACATCCAGATGTGATGCGTGCCA
TTAGCCAGGGCGTGGCCGAGTGGACAGCAGAATGCCAGCACCAGTTCCGCCAGCACCGCT
GGAATTGCAACACCCTGGACAGGGATCACAGCCTTTTTGGCAGGGTCCTACTCCGAAGTA
GTCGGGAATCTGCCTTTGTTTATGCCATCTCCTCAGCTGGAGTTGTATTTGCCATCACCA
GGGCCTGTAGCCAAGGAGAAGTAAAATCCTGTTCCTGTGATCCAAAGAAGATGGGAAGCG
CCAAGGACAGCAAAGGCATTTTTGATTGGGGTGGCTGCAGTGATAACATTGACTATGGGA
TCAAATTTGCCCGCGCATTTGTGGATGCAAAGGAAAGGAAAGGAAAGGATGCCAGAGCCC
TGATGAATCTTCACAACNAACAGAGCTGCANGAAAGCTGTANAGCGGTTCTTGAAACAAG
AGTGCAAGTGCCACGGGGTGAGCGGCTCATGTACTCTCANGACATGCTGGCTGGCCCATG
CCGACTTCANGAAAACCGGCGATTATCTCTGGNAGAAGTACAATGGGCCATCCCAGTGGT
CATGAACCAGGATGCAACANGTTCACTTGTGCTAACGAGAGGTTTAGAAGCCACGAAAAT
GTACTCGTGTATTTTGAGAATCTTCAAATACTGTTCAAGCACCGANAGCCAGCTCCCTGG
TACGCN
>OriGene 3' read for NM_003391 unedited
GGAATTCGCTTTGCTTNCATTCAAATTAAAAAAACGGTGCAGGNNCAGCCTNNCTCCATT
TTCCCTGGATGTCATCTTTTGGCTGATGGCAGAAGCCAACCACTATTTGCATACTGATGC
TCCCATAATTACAGTTGAGTCCCTTAAACATAGTCTCCAAGTTACGATTTGTTTGCAATA
TAATATAGCAGGGTTACCAACTTTATAAGCAATGCTATGTGTCATTTGCTTTAGGCTACA
GTATCACATCATCTTGTAAGCATCAAATAAATACAATTAAATATGACAGGTCTTTAAACT
GGGCTTGAAGGGTGATGGGCATTAGCAGACGGCGGACGTGGCCGACTTCTTTCAGGCATC
TGCTTATTGTAAGGCCGCCCCAGGCACGAGTTAGCTCTGGAAACCTCTCTGTCAGCATTT
TAGTTCACCAATCTTGTATCCCCAAAATTTTCATCCTTCAAGTCTTTCAGTTATGAGATT
CCATGGGTCACATGCATAATATGAGATAGGAATTTTATTCTCCCTTTTTTTCTTGATCTG
TACAGATATACTTCTGATATTCCATCCACTAAATTATTTTCCACCATATTCACCCAATAG
TTACAGAATATTGCCAGACCATTCATCTTTCTTTTTAATTCCCTTCGGATTCTAAGTGAG
AAGGAACCTCTCATTCCCTTAAAGATTTTTTATTTCAAGGTGACAGGTAATGCCAAAGCA
ATCCCTTTTCTGAGGCTTTTGGCTCTTACAAAGATACCACCCACCCTTATTCCCCAAGGA
CACACGTCCCCACCCTTGTTACATCAGAATTTTATATGGGGAAATAAATGCCTTGGANAA
TTCACCTTTTTAAACTTAAAAGGGTATTGAAAGCCCTTTTTTTTCCGGTAATTACCCATT
TACCCTAAGGGTGGAAACCTTAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003391
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003391.1, NP_003382.1
RefSeq Size 2301 bp
RefSeq ORF 1083 bp
Locus ID 7472
Cytogenetics 7q31.2
Domains wnt
Protein Families Adult stem cells, Cancer stem cells, ES Cell Differentiation/IPS, Secreted Protein, Stem cell relevant signaling - Wnt Signaling pathway
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
Gene Summary This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript.

Other Versions

Other products for "WNT2"
Frequently bought together (2)
Rabbit Polyclonal Anti-WNT2 Antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools