SLC7A5 (NM_003486) Human Untagged Clone

CAT#: SC117965

SLC7A5 (untagged)-ORIGENE UNIQUE VARIANT 1 of Human solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 (SLC7A5)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SLC7A5 (NM_003486) Human Untagged Clone
Symbol SLC7A5
Synonyms 4F2LC; CD98; D16S469E; E16; hLAT1; LAT1; MPE16
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_003486, the custom clone sequence may differ by one or more nucleotides


ATGGCGGGTGCGGGCCCGAAGCGGCGCGCGCTAGCGGCGCCGGCGGCCGAGGAGAAGGAAGAGGCGCGGG
AGAAGATGCTGGCCGCCAAGAGCGCGGACGGCTCGGCGCCGGCAGGCGAGGGCGAGGGCGTGACCCTGCA
GCGGAACATCACGCTGCTCAACGGCGTGGCCATCATCGTGGGGACCATTATCGGCTCGGGCATCTTCGTG
ACGCCCACGGGCGTGCTCAAGGAGGCAGGCTCGCCGGGGCTGGCGCTGGTGGTGTGGGCCGCGTGCGGCG
TCTTCTCCATCGTGGGCGCGCTCTGCTACGCGGAGCTCGGCACCACCATCTCCAAATCGGGCGGCGACTA
CGCCTACATGCTGGAGGTCTACGGCTCGCTGCCCGCCTTCCTCAAGCTCTGGATCGAGCTGCTCATCATC
CGGCCTTCATCGCAGTACATCGTGGCCCTGGTCTTCGCCACCTACCTGCTCAAGCCGCTCTTCCCCACCT
GCCCGGTGCCCGAGGAGGCAGCCAAGCTCGTGGCCTGCCTCTGCGTGCTGCTGCTCACGGCCGTGAACTG
CTACAGCGTGAAGGCCGCCACCCGGGTCCAGGATGCCTTTGCCGCCGCCAAGCTCCTGGCCCTGGCCCTG
ATCATCCTGCTGGGCTTCGTCCAGATCGGGAAGGGTGATGTGTCCAATCTAGATCCCAACTTCTCATTTG
AAGGCACCAAACTGGATGTGGGGAACATTGTGCTGGCATTATACAGCGGCCTCTTTGCCTATGGAGGATG
GAATTACTTGAATTTCGTCACAGAGGAAATGATCAACCCCTACAGAAACCTGCCCCTGGCCATCATCATC
TCCCTGCCCATCGTGACGCTGGTGTACGTGCTGACCAACCTGGCCTACTTCACCACCCTGTCCACCGAGC
AGATGCTGTCGTCCGAGGCCGTGGCCGTGGACTTCGGGAACTATCACCTGGGCGTCATGTCCTGGATCAT
CCCCGTCTTCGTGGGCCTGTCCTGCTTCGGCTCCGTCAATGGGTCCCTGTTCACATCCTCCAGGCTCTTC
TTCGTGGGGTCCCGGGAAGGCCACCTGCCCTCCATCCTCTCCATGATCCACCCACAGCTCCTCACCCCCG
TGCCGTCCCTCGTGTTCACGTGTGTGATGACGCTGCTCTACGCCTTCTCCAAGGACATCTTCTCCGTCAT
CAACTTCTTCAGCTTCTTCAACTGGCTCTGCGTGGCCCTGGCCATCATCGGCATGATCTGGCTGCGCCAC
AGAAAGCCTGAGCTTGAGCGGCCCATCAAGGTGAACCTGGCCCTGCCTGTGTTCTTCATCCTGGCCTGCC
TCTTCCTGATCGCCGTCTCCTTCTGGAAGACACCCGTGGAGTGTGGCATCGGCTTCACCATCATCCTCAG
CGGGCTGCCCGTCTACTTCTTCGGGGTCTGGTGGAAAAACAAGCCCAAGTGGCTCCTCCAGGGCATCTTC
TCCACGACCGTCCTGTGTCAGAAGCTCATGCAGGTGGTCCCCCAGGAGACATAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_003486 unedited
NGTTCANATTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGCACGAGGCGCTCGGCT
GCGGCTCCCGGGTGTCCCAGGCCCGGCCGGTAAGCAGAGCATGGCGGGTGCGGGCCCGAA
GCGGCGCGCGCTAGCGGCCCCGGTGGCCGAGGAGAAGGAAGAGGCGCGGGAGAAGATAAT
GGCCGCCAAGCGCGCGGACGGCGCGGCGCCGGCAGGCGAGGGCGAGGGCGTGACCCTGCA
GGGGAACATCACGCTACTCAAGGGCGTGGCCGTCATCGTGGTCGCCATCATGGGCTCGGG
CATCTTCGTGACGTCCACGGGCGTGCTCAGGGAGGCAGGCTCGCCGGGGCTGGCGCTGGT
GGTGTGGGCCGCGTGCGGCGTCTTCTCCATCGTGGGCGCGCTCTGCTACGCGGAGCTGGG
CACCACCATCTCCAAATCGGGCGGCGACTACGCCTACATGCTGGACGTCTACGGCTCGCT
GCCCGCCTTCCTCAAGCTCTGGATCGAGCTGCTCATCATCCGGCCTTCATCGCAGTACAT
CGTGGCCCTGGTCTTCGCCACCTACCTGCTCAAGCCGCTCTTCCCCACCTGCCCGGTGCC
CGAGGAGGCAGCCAAGCTCGTAGCCTGCCACTGCGTGCTAGCAAATTGCTTCAGGAGTTG
AGACAGGAGGGAGCTTGCTGTCGCGGCCTTCTTTGTGCTTCTCTGAGCTATGAGGCTGAG
ATGATCTTCAAGTGGATTTTTAGCANATTTAGCTCATCTGNCAAGAATGAAGTTAAAGTC
CTCTACTTATGTGCCACCTACANAGCACTAGAGACTGGTANGAGAAAAGAAAGCCTTTTC
ATTCTGTATGCAGCTTTGTATGACCAGCCTGCAGTCAATCTTGNAAATGTGGATACACCA
GAATGCTC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003486
ORF Size 1524 bp
Insert Size 5730
OTI Disclaimer The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required.
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003486.5, NP_003477
RefSeq Size 4543
RefSeq ORF 1524
Locus ID 8140
Cytogenetics 16q24.2
Domains aa_permeases
Protein Families Transmembrane, Druggable Genome
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.