COX7A2L (NM_004718) Human Untagged Clone

CAT#: SC117225

COX7A2L (untagged)-Human cytochrome c oxidase subunit VIIa polypeptide 2 like (COX7A2L), nuclear gene encoding mitochondrial protein

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name COX7A2L (NM_004718) Human Untagged Clone
Symbol COX7A2L
Synonyms COX7AR; COX7RP; EB1; SIG81
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC117225 sequence for NM_004718 edited (data generated by NextGen Sequencing)
ATGTACTACAAGTTTAGTGGCTTCACGCAGAAGTTGGCAGGAGCATGGGCTTCGGAGGCC
TATAGCCCGCAGGGATTAAAGCCTGTGGTTTCCACAGAAGCACCACCTATCATATTTGCC
ACACCAACTAAACTGACCTCCGATTCCACAGTGTATGATTATGCTGGGAAAAACAAAGTT
CCAGAGCTACAAAAGTTTTTCCAGAAAGCTGATGGTGTGCCCGTCTACCTGAAACGAGGC
CTGCCTGACCAAATGCTTTACCGGACCACCATGGCGCTGACTGTGGGAGGGACCATCTAC
TGCCTGATCGCCCTCTACATGGCTTCGCAGCCCAAAAACAAATGA

Clone variation with respect to NM_004718.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004718 unedited
AAGTCAGAATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGGTCCTTCT
CTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATGTACTACA
AGTTTAGTGGCTTCACGCAGAAGTTGGCAGGAGCATGGGCTTCGGAGGCCTATAGCCCGC
AGGGATTAAAGCCTGTGGTTTCCACAGAAGCACCACCTATCATATTTGCCACACCAACTA
AACTGACCTCCGATTCCACAGTGTATGATTATGCTGGGAAAAACAAAGTTCCAGAGCTAC
AAAAGTTTTTCCAGAAAGCTGATGGTGTGCCCGTCTACCTGAAACGAGGCCTGCCTGACC
AAATGCTTTACCGGACCACCATGGCGCTGACTGTGGGAGGGACCATCTACTGCCTGATCG
CCCTCTACATGGCTTCGCAGCCCAAAAACAAATGAGTTAGGCTGCAGAGGACTGGTTTGT
TTTTTGGCATAAACCCTTTGAAGTTCCTTTTTCATTGTTAAATTAAAATTTTTTTTTTTA
CTTGGATGGCTTAACATTTTTGCAAGAAAAATAGGAAGATATGAAGATGATGTTNTTGGT
TTGTTTATGAAATGCATATGGCTTGTCAGAGCTCATTCGACAGTTAAAGCCATTGTTTAA
AGAAATGGTGCTTTGCTCTGTGTTTGTGCTCCTGATTTCCCTGGAGGTTCTGGATGAAGG
CTGAACACAGGCTTGTTAATGTCAGTCTGTGCTGAGGACCTCAGGACNTTGAGGTTGCAT
TTTTGAGCATGGGGTGCANGAGCCTTTCTGGATTTTGGATGTGGCTATNGGAAAGAACAC
AGAGCAAGGTCATGTGCATGAATGGAGGAGTTTGAGTTAGTCCCTCGGGGGATTTTTTCC
ATTTTGCAGTAAATGTTAAATTAATGTACCTGCCTCTATT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004718 unedited
CGGCCGCAATCTAAAGTCGAGTTTTTTTTTTTTTTTTTTAATTTTTCATTCATGTATTTA
TTCCACAGTCAAAATAAATCAAAATTTAAAGCTATAACATTTTTAAAAGATAAAGGAGAA
TTTGTGGCACAGCTGCATTAACAAAACAGACACCAGTCTAAAGTGCAACACTAAACAGGT
ATTCTCTGTTCCCACGGTGGAATAATTACACATAAGATTTCACTAAAGATAGGAGATGAG
GCAAATAACCCTTTGAAATTACCTGCCCAACAAATAGAGGCAGGCTACATTAATTTAACA
TTTTACTGCAAAATGGAAAAAATCCCCGAGGTGACTAACTCAAACTCCTCATTTCATGCA
CATGACCTTGGCTTCTGTGTTCTTTCCATAGCCACATCCAAATCCAGAAAGGCTCCTGCA
CCCCATGCTCAAAAATGCAACCTCAAGTCCCTGAGGTCCTCAGCACAGACTGACATTAAC
AAGCCTGTGTTCAGCCTTCATCCAGAACCTCCAGGGAAATCAGGAGCACAAACACAGAGC
AAAGCACCATTTCTTTAAACAATGGCTTTAACTGTCGAATGAGCTCTGACAAGCCATATG
CATTTCATAAACAAACCAAAACATCATCTTCATATCTTCCTATTTTTCTTGCAAAAATGT
TAAGCCATCCAANGTAAAAAAAAAATTTAATTTAACAATGAAAAAGGAACTTNCAAGGGT
TTATGCCAAAAAACAAACCAGTCCTCTGCAGCCTAACTCATTTGTTTTTGGGGCTGCGAA
GCCATGTAGAGGGCGATCAGGCAGTAGATGGTCCCCTCCACAGTCAGCGCCATGGTGGTC
CCGTTAAGCATTTGGTCAGGCAGCCCTCGTTTCAGTACACGGCCACACCATCAAGCTTCT
GGAAACACTTTTGTAGCTCTGGAACTCTGGTTTTCCACCCATATCTACCCTGGGGATCGG
AGTCATTTTATTTGTGTGGCAAAATGATAGGCGTGCTCCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004718
ORF Size 345 bp
Insert Size 1110
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004718.2, NP_004709
RefSeq Size 1145
RefSeq ORF 345
Locus ID 9167
Cytogenetics 2p21
Domains COX7a
Protein Families Transmembrane, Druggable Genome
Protein Pathways Oxidative phosphorylation, Cardiac muscle contraction, Alzheimer's disease, Parkinson's disease, Huntington's disease
Gene Summary Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein similar to polypeptides 1 and 2 of subunit VIIa in the C-terminal region, and also highly similar to the mouse Sig81 protein sequence. This gene is expressed in all tissues, and upregulated in a breast cancer cell line after estrogen treatment. It is possible that this gene represents a regulatory subunit of COX and mediates the higher level of energy production in target cells by estrogen. Several transcript variants, some protein-coding and others non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016].
Transcript Variant: This variant (1) represents the predominant transcript and encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.