ABCG2(ABCG2) (NM_004827) Human Untagged Clone

CAT#: SC117127

ABCG2 (untagged)-Human ATP-binding cassette, sub-family G (WHITE), member 2 (ABCG2)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ABCG2(ABCG2) (NM_004827) Human Untagged Clone
Symbol ABCG2
Synonyms ABC15; ABCP; BCRP; BCRP1; BMDP; CD338; CDw338; EST157481; GOUT1; MRX; MXR; MXR-1; MXR1; UAQTL1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004827 edited
TGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGG
ACCGAGCTCTATTAAGCTGAAAAGATAAAAACTCTCCAGATGTCTTCCAGTAATGTCGAA
GTTTTTATCCCAGTGTCACAAGGAAACACCAATGGCTTCCCCGCGACAGCTTCCAATGAC
CTGAAGGCATTTACTGAAGGAGCTGTGTTAAGTTTTCATAACATCTGCTATCGAGTAAAA
CTGAAGAGTGGCTTTCTACCTTGTCGAAAACCAGTTGAGAAAGAAATATTATCGAATATC
AATGGGATCATGAAACCTGGTCTCAACGCCATCCTGGGACCCACAGGTGGAGGCAAATCT
TCGTTATTAGATGTCTTAGCTGCAAGGAAAGATCCAAGTGGATTATCTGGAGATGTTCTG
ATAAATGGAGCACCGCGACCTGCCAATTTCAAATGTAATTCAGGTTACGTGGTACAAGAT
GATGTTGTGATGGGCACTCTGACGGTGAGAGAAAACTTACAGTTCTCAGCAGCTCTTCGG
CTTGCAACAACTATGACGAATCATGAAAAAAACGAACGGATTAACAGGGTCATTCAAGAG
TTAGGTCTGGATAAAGTGGCAGACTCCAAGGTTGGAACTCAGTTTATCCGTGGTGTGTCT
GGAGGAGAAAGAAAAAGGACTAGTATAGGAATGGAGCTTATCACTGATCCTTCCATCTTG
TTCTTGGATGAGCCTACAACTGGCTTAGACTCAAGCACAGCAAATGCTGTCCTTTTGCTC
CTGAAAAGGATGTCTAAGCAGGGACGAACAATCATCTTCTCCATTCATCAGCCTCGATAT
TCCATCTTCAAGTTGTTTGATAGCCTCACCTTATTGGCCTCAGGAAGACTTATGTTCCAC
GGGCCTGCTCAGGAGGCCTTGGGATACTTTGAATCAGCTGGTTATCACTGTGAGGCCTAT
AATAACCCTGCAGACTTCTTCTTGGACATCATTAATGGAGATTCCACTGCTGTGGCATTA
AACAGAGAAGAAGACTTTAAAGCCACAGAGATCATAGAGCCTTCCAAGCAGGATAAGCCA
CTCATAGAAAAATTAGCGGAGATTTATGTCAACTCCTCCTTCTACAAAGAGACAAAAGCT
GAATTACATCAACTTTCCGGGGGTGAGAAGAAGAAGAAGATCACAGTCTTCAAGGAGATC
AGCTACACCACCTCCTTCTGTCATCAACTCAGATGGGTTTCCAAGCGTTCATTCAAAAAC
TTGCTGGGTAATCCCCAGGCCTCTATAGCTCAGATCATTGTCACAGTCGTACTGGGACTG
GTTATAGGTGCCATTTACTTTGGGCTAAAAAATGATTCTACTGGAATCCAGAACAGAGCT
GGGGTTCTCTTCTTCCTGACGACCAACCAGTGTTTCAGCAGTGTTTCAGCCGTGGAACTC
TTTGTGGTAGAGAAGAAGCTCTTCATACATGAATACATCAGCGGATACTACAGAGTGTCA
TCTTATTTCCTTGGAAAACTGTTATCTGATTTATTACCCATGAGGATGTTACCAAGTATT
ATATTTACCTGTATAGTGTACTTCATGTTAGGATTGAAGCCAAAGGCAGATGCCTTCTTC
GTTATGATGTTTACCCTTATGATGGTGGCTTATTCAGCCAGTTCCATGGCACTGGCCATA
GCAGCAGGTCAGAGTGTGGTTTCTGTAGCAACACTTCTCATGACCATCTGTTTTGTGTTT
ATGATGATTTTTTCAGGTCTGTTGGTCAATCTCACAACCATTGCATCTTGGCTGTCATGG
CTTCAGTACTTCAGCATTCCACGATATGGATTTACGGCTTTGCAGCATAATGAATTTTTG
GGACAAAACTTCTGCCCAGGACTCAATGCAACAGGAAACAATCCTTGTAACTATGCAACA
TGTACTGGCGAAGAATATTTGGTAAAGCAGGGCATCGATCTCTCACCCTGGGGCTTGTGG
AAGAATCACGTGGCCTTGGCTTGTATGATTGTTATTTTCCTCACAATTGCCTACCTGAAA
TTGTTATTTCTTAAAAAATATTCTTAAATTTCCCCTTAATTCAGTATGATTTATCCTCAC
ATAAAAAAGAAGCACTTTGATTGAAGTATTCAATCAAGTTTTTTTGTTGTTTTCTGTTCC
CTTGCCA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004827 unedited
NGGCCGCTCAGGATTTTCGTAAACGACTTACTATAGGCGGCCGCGAATTCGCACGAGAAC
CGAGCTCTATTAAGCTGAAAAAATAAAAACTCTCCAGATGTCTTCCAGTAATGTCGAAGT
TTTTATCCCAGTGTCACAAGGAAACACCAATGGCTTCCCCGCGACAGCTTCCAATGACCT
GAAGGCATTTACTGAAGGAGCTGTGTTAAGTTTTCATAACATCTGCTATCGAGTAAAACT
GAAGAGTGGCTTTCTACCTTGTCGAAAACCAGTTGAGAAAGAAATATTATCGAATATCAA
TGGGATCATGAAACCTGGTCTCAACGCCATCCTGGGACCCACAGGTGGAGGCAAATCTTC
GTTATTAGATGTCTTAGCTGCAAGGAAAGATCCAAGTGGATTATCTGGAGATGTTCTGAT
AAATGGAGCACCGCGACCTGCCAATTTCAAATGTAATTCAGGTTACGTGGTACAAGATGA
TGTTGTGATGGGCACTCTGACGGTGAGAGAAAACTTACAGTTCTCAGCAGCTCTTCGGCT
TGCAACAACTATGACGAATCATGAAAAAAACGAACGGATTAACAGGGTCATTCAAGAGTT
AGGTCTGGATAAAGTGGCAGACTCCAAGGTTGGAACTCAGTTTATCCGTGGTGTGTCTGG
AGGAGAAAGAAAAAGGACTAGTATAGGAATGGAGCTTATCACTGATCCTTCCATCTTGTT
CTTGGATGAGCCTACAACTGGCTTAGACTCAAGCACAGCANATGCTGTCCTTTTGCTCCT
GAAAGGATGTCTAAGCAGGNACGAACAATCATCTTCTCCATTCATCAGCCTCGATATTCC
ATCTTCAAGTTGTTGATAGCCTCACCTTATTNGCCTCANGAAGACTTATGNTNCACGGNC
CCTGCTCAGNAGCCTTNGGGATCTTTGAAATCAGCTGTTATCACTGTGGAGGCCTATAT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004827 unedited
ACTTGGACGCGGCCGCATCTATGATCAGTTTTTTTTTTTTTTTTTTTAAGTTCTATTAAC
TTTAATGTGCTTATCAAAAAGATTTTTTTCTATCACGGAGGCTTTTTTTACCCTATAAGA
CAGAATCTTTTTTCCAACATATTTTCAATTTTACATTTCCAGTATAGCATTAATACATTT
GTCATTTATTAAATAATGGCAAACCATAGCATCATAAAGTATTAAGACTGAAGGGCTACT
AACCTACCTATTCATTTTAAAGATGAGGAAACAAATGCCAGAGACAGTAATAACTTGTCA
GGAGTTTCCAGAATTCAATTCTCCTTTTTTAGATTAATAAATTAGACCAGATTTCTTCCC
CATGGTTACTGTCTGAGGAGATTAACTAATATGCGATACATGATGTCTTGGGTTCTTTCA
TGTTTAATTCAGTTTGTTGAGATTTCTAAAAATGTATCTCTTTAAAACAATTGCTGCTGT
GCAACAGTGTGATGGCAAGGGAACAGAAAACAACAAAAAAACTTGATTGAATACTTCAAT
CAAAGTGCTTCTTTTTTATGTGAGGATAAATCATACTGAATTAAGGGGAAATTTAAGAAT
ATTTTTTAAGAAATAACAATTTCAGGTAGGCAATTGTGAGGAAAATAACAATCATACAAG
CCAAGGCCACGTGATTCTTCCACAAGCCCCAGGGTGAGAGATCGATGCCCTGCTTTACCA
AATATTCTTCGCCAGTACATGTTGCATAGTTACAAAGATTGTTTCCTGTTGCATTGAGTC
CTGAGCAGAAGTTTTGTCCCAAAATCCATTATGCTGCAAAGCCGTAAATCCATATCGNGG
AATGCTCGAGTACTGGAGCCATGACAGNCCAGAATGCATGGGTTGTGAGATTGCACANCA
GACCTGAAAAAATCTCATAAACACAAACAGATGTCCTGANAAATGTGCTACGAAACCCAC
TCTGTACTGCTGCTATGGCANTGCCATG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004827
ORF Size 1968 bp
Insert Size 2700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004827.2, NP_004818
RefSeq Size 4445
RefSeq ORF 1968
Locus ID 9429
Cytogenetics 4q22.1
Domains ABC_tran, AAA
Protein Families ES Cell Differentiation/IPS, Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary The membrane-associated protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. Alternatively referred to as a breast cancer resistance protein, this protein functions as a xenobiotic transporter which may play a major role in multi-drug resistance. It likely serves as a cellular defense mechanism in response to mitoxantrone and anthracycline exposure. Significant expression of this protein has been observed in the placenta, which may suggest a potential role for this molecule in placenta tissue. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations