AKT1 (NM_005163) Human Untagged Clone

CAT#: SC116883

Reviews ()
Write a review

AKT1 (untagged)-Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 1



  "NM_005163" in other vectors (7)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name AKT1 (NM_005163) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol AKT1
Synonyms AKT; CWS6; PKB; PKB-ALPHA; PRKBA; RAC; RAC-ALPHA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_005163 edited
ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAG
ACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAG
CGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGC
CAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGG
ACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACA
ACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTC
CGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAG
CCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACT
TTCGGCAAGGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATC
CTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGC
GTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCAC
GACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCC
CGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCC
CTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTC
ATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATC
AAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTG
CTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTAC
GAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTC
ATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTT
TCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAG
GAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAG
CTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAG
GAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGT
GTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCC
TGA
>OriGene 5' read for NM_005163 unedited
GTCACCATTTGTATACGACTCATATAGGCGGCNCGCGATTCGGCACGAGGAAGTACTTGG
GGCATTTCCCTCTTTGGAGGCTGTGGCCAGGCCAGCTGGGCTCGGGGAGCGCCAGCCTGA
GAGGAGCGCGTGAGCGTTGCGGGAGCCTCGGGCACCATGAGCGACGTGGCTATTGTGAAG
GAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAGACCTGGCGGCCACGCTACTTCCTC
CTCAAGAATGATGGCACCTTCATTGGCTACAAGGAGCGGCCGCAGGATGTGGACCAACGT
GAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGCCAGCTGATGAAGACGGAGCGGCCC
CGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGGACCACTGTCATCGAACGCACCTTC
CATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACAACCGCCATCCAGACTGTGGCTGAC
GGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTCCGGTCGGGCTCACCCAGTGACAAC
TCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGCGTGACCATGAAC
GANGTTGAGTACCTGAAGCTGCTGGGCAAGGGCACTNTCGGCAAGGTGATCCTGGTGAAG
GAGAAGCCACAGGCCGCTACTACGCCATGAAGATCCTCAAGAANGAGTCATCGTGGCCAA
GGACGANGTGGCCCACACACTCACCGAGAACCCGCGTCCTGCANAACTCCAGGCACCCCT
TNCTCACAGCCCTGAAGTACTCTTTCCAGACCACGACCGCCTCTGCTTTGTCATGGAGTA
CAGCCACGGGGGCGAGCTGNTCTTCCACCTGTCCCGGNAGCGTGTGTNCTCCGAGACCGG
CCCGCTTCTATGCGCTGAGAT
>OriGene 3' read for NM_005163 unedited
CCGCGGCACGCAATCTAGTATCGAGTTTTTTTTTTTTTTTTTTGAAAACAACTTTTATTG
AAGAATTTGGAGGGAAGGTTCCATATTATATTATAATAGTAAAAATACTAAAGTTGAATG
TTGTAAAAAAACGCCGTGGTGCATCGGCAGCGGCAGCGTCTGGCCAGGATGCGTGGAGGG
GCCCATGGATGGCCACCCCCACAGGGAGTCAGGGAGGGCCTGGGGCGACAGCGGAAAGGT
TAAGCGTCGAAAAGGTCAAGTGCTACCGTGGAGAGATCATCTGAGGGGGAGGCTCCCGGT
GGGACAGTCACCAAGAACTGTGACACAGAAGGGGAAGGGGGAGGGCTTTCCTGTCACAAA
GATTAAAAACCCCCAAAATGCATTTGAACAACATAATACACAATAACAAATTTAAACCTT
GCTCCTCTGTCCCACTGGGTAAACCCTGGCCCATCCCCCATCCCTGGTCCCATCCCATGG
GCCCAGCCTCCGATGACGTCCTCAGAGACACGGCCTTATTGCTGGGGGGCTGCTGTGTGC
CTGCCACCCCCAGGAGAGGGTGCTGGCCAGCATACCATAGTGAGGTTGCATCTGGTGCCA
CCAGGTTGAACTGATGCCCATGGCCCCAGAGAGATGACAGATAGCTGGTGACAGACAGCC
CAGGGCGGCTGGCTGACAGAGTGAGGGGACACATGGGCAGGACCTTGCTGGCCCCCCAAT
GCCACATTGCGCATAGCTGCAGAAATCCCTAACATTTCCCTACGTGAATCGGATTGTTCT
GAAGGCTGAAGCCCCCCCCGGAGGACAAACTGGATGAATAAATAAAACCCGCGGATATTT
TTTTTCCTCCCCGCTGCGGGGGAGTTGCTGNCCAAGCACAAAACTTTTTCTTTGGGCTCA
AAGGCCCGGGGTTTTCTCATGCCCCCGGAATAAACCCTATTCCGATCTGCCCGAGGG
Restriction Sites NotI-NotI     
ACCN NM_005163
Insert Size 2380 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005163.2, NP_005154.2
RefSeq Size 3008 bp
RefSeq ORF 1443 bp
Locus ID 207
Cytogenetics 14q32.33
Domains pkinase, S_TK_X, TyrKc, PH, S_TKc
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase
Protein Pathways Acute myeloid leukemia, Adipocytokine signaling pathway, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Glioma, Insulin signaling pathway, Jak-STAT signaling pathway, MAPK signaling pathway, Melanoma, mTOR signaling pathway, Neurotrophin signaling pathway, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer, Renal cell carcinoma, Small cell lung cancer, T cell receptor signaling pathway, Tight junction, Toll-like receptor signaling pathway, VEGF signaling pathway
Gene Summary The serine-threonine protein kinase encoded by the AKT1 gene is catalytically inactive in serum-starved primary and immortalized fibroblasts. AKT1 and the related AKT2 are activated by platelet-derived growth factor. The activation is rapid and specific, and it is abrogated by mutations in the pleckstrin homology domain of AKT1. It was shown that the activation occurs through phosphatidylinositol 3-kinase. In the developing nervous system AKT is a critical mediator of growth factor-induced neuronal survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating the serine/threonine kinase AKT1, which then phosphorylates and inactivates components of the apoptotic machinery. Mutations in this gene have been associated with the Proteus syndrome. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (1) is the longest transcript. Variants 1, 2 and 3 encode the same protein.

Citations (4)

Other Versions

Other products for "AKT1"
Frequently bought together (2)
AKT1 mouse monoclonal antibody, clone OTI4D6 (formerly 4D6)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools