GRPR (NM_005314) Human Untagged Clone

CAT#: SC116819

GRPR (untagged)-Human gastrin-releasing peptide receptor (GRPR)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GRPR (NM_005314) Human Untagged Clone
Symbol GRPR
Synonyms BB2; BB2R
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC116819 sequence for NM_005314 edited (data generated by NextGen Sequencing)
ATGGCTCTAAATGACTGTTTCCTTCTGAACTTGGAGGTGGACCATTTCATGCACTGCAAC
ATCTCCAGTCACAGTGCGGATCTCCCCGTGAACGATGACTGGTCCCACCCGGGGATCCTC
TATGTCATCCCTGCAGTTTATGGGGTTATCATTCTGATAGGCCTCATTGGCAACATCACT
TTGATCAAGATCTTCTGTACAGTCAAGTCCATGCGAAACGTTCCAAACCTGTTCATTTCC
AGTCTGGCTTTGGGAGACCTGCTCCTCCTAATAACGTGTGCTCCAGTGGATGCCAGCAGG
TACCTGGCTGACAGATGGCTATTTGGCAGGATTGGCTGCAAACTGATCCCCTTTATACAG
CTTACCTCTGTTGGGGTGTCTGTCTTCACACTCACGGCGCTCTCGGCAGACAGATACAAA
GCCATTGTCCGGCCAATGGATATCCAGGCCTCTCATGCCCTGATGAAGATCTGCCTCAAA
GCCGCCTTTATCTGGATCATCTCCATGCTGCTGGCCATTCCAGAGGCCGTGTTTTCTGAC
CTCCATCCCTTCCATGAGGAAAGCACCAACCAGACCTTCATTAGCTGTGCCCCATACCCA
CACTCTAATGAGCTTCACCCCAAAATCCATTCTATGGCTTCCTTTCTGGTCTTCTACGTC
ATTCCACTGTCGATCATCTCTGTTTACTACTACTTCATTGCTAAAAATCTGATCCAGAGT
GCTTACAATCTTCCCGTGGAAGGGAATATACATGTCAAGAAGCAGATTGAATCCCGGAAG
CGACTTGCCAAGACAGTGCTGGTGTTTGTGGGCCTGTTCGCCTTCTGCTGGCTCCCCAAT
CATGTCATCTACCTGTACCGCTCCTACCACTACTCTGAGGTGGACACCTCCATGCTCCAC
TTTGTCACCAGCATCTGTGCCCGCCTCCTGGCCTTCACCAACTCCTGCGTGAACCCCTTT
GCCCTCTACCTGCTGAGCAAGAGTTTCAGGAAACAGTTCAACACTCAGCTGCTCTGTTGC
CAGCCTGGCCTGATCATCCGGTCTCACAGCACTGGAAGGAGTACAACCTGCATGACCTCC
CTCAAGAGTACCAACCCCTCCGTGGCCACCTTTAGCCTCATCAATGGAAACATCTGTCAC
GAGCGGTATGTCTAG

Clone variation with respect to NM_005314.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005314 unedited
NGGTCAAAATTGTATACGACTCACTATAGGGCGGCCGCGATTCGCCCTTCTTATCTTCAT
CTTCACTCGGTTGCAAAATCAATAGTTAAGAAATAGCATCTAAGGGAACTTTTAGGTGGN
GAAAAAAAATCTAGAGATGGCTCTAAATGACTGTTTCCTTCTGAACTTGGAGGTGGACCA
TTTCATGCACTGCAACATCTCCAGTCACAGTGCGGATCTCCCCGTGAACGATGACTGGTC
CCACCCGGGGATCCTCTATGTCATCCCTGCAGTTTATGGGGTTATCATTCTGATAGGCCT
CATTGGCAACATCACTTTGATCAAGATCTTCTGTACAGTCAAGTCCATGCGAAACGTTCC
AAACCTGTTCATTTCCAGTCTGGCTTTGGGAGACCTGCTCCTCCTAATAACGTGTGCTCC
AGTGGATGCCAGCAGGTACCTGGCTGACAGATGGCTATTTGGCAGGATTGGCTGCAAACT
GATCCCCTTTATACAGCTTACCTCTGTTGGGGTGTCTGTCTTCACACTCACGGCGCTCTC
GGCAGACAGATACAAAGCCATTGTCCGGCCAATGGATATCCAGGCCTCTCATGCCCTGAT
GAAGATCTGCCTCAAAGCCGCCTTTATCTGGATCATCTCCATGCTGCTGGCCATTCCAGA
GGCCGTGTTTTCTGACCTCCATCCCTTCCATGAGGAAAGCACCAACCAGACCTTCATTAG
CTGTGCCCCATACCCACACTCTAATGAGCTTCACCCCAAAATCCATTCTATGGCTTCCTT
TCTGGTCTTCTACGTCATTCCACTGTCGATCATCTCTGTTTACTACTACTTCATTGCTAA
AAATCTGATCCAGAGTGCTTACCATCTTCCCGTGGAAGGAATATACATGTCAAGAAGCAG
ATTGAATCCCNGAAGCGACTTGNNCAGACGTGCTGGTGTTTGTGG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005314 unedited
NNGGGCCATGGGGATGGCAACTTCCAGGGCCAGNAAAGCACTGGGGNAGGGTCACAGGGA
TGCCACCCGGGATCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGACAA
GCTTGATATCGGTACCAGATCTGAATTCGCCCTTCACCTACACCACTCAGGAGCATTCTG
AAGGCTCTTTGGAGGGCACAGACACAACAATGGATGCAAGGGTTCCTGTCTAGCCATAAA
GCAAAACCGTCCCTCAGGGGGCAAAATCAAGGGTCAATCTAGACATACCGCTCGTGACAG
ATGTTTCCATTGATGAGGCTAAAGGTGGCCACGGAGGGGTTGGTACTCTTGAGGGAGGTC
ATGCAGGTTGTACTCCTTCCAGTGCTGTGAGACCGGATGATCAGGCCAGGCTGGCAACAG
AGCAGCTGAGTGTTGAACTGTTTCCTGAAACTCTTGCTCAGCAGGTAGAGGGCAAAGGGG
TTCACGCAGGAGTTGGTGAAGGCCAGGAGGCGGGCACAGATGCTGGTGACAAAGTGGAGN
CATGGAGGTGTCCACCTCAGAGTAGTGGTAGGAGCGGTACAGGTAGATGACATGATTGGG
GAGCCAGCAGAAGGCGAACAGGCCCACAAACACCAGCACTGTCTTGGCAAGTCGCTTCCG
GGATTCAATCTGCTTCTTGACATGTATATTCCCTTCCCGGGAAGATTGTAGCACTCTGGA
TCAGATTTTTAGCAATGAAGTAGTAGTAAACAGAGATGATCGACAGTGAATGACGTAGAA
GACCAGAAAGGAGCATAGATGGNATTTGGGGGTAAGCTCATAAGTGTGGGGTATGGGCAC
ATAATGAAGNNGNGGGGGGGGCTTCTCATGAGGGGGTGGGGGGGGAAAAAACCCGCTTTT
GGAGTCACAN
Tag Tag Free
ACCN NM_005314
ORF Size 1155 bp
Insert Size 1700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005314.2, NP_005305
RefSeq Size 2681
RefSeq ORF 1155
Locus ID 2925
Cytogenetics Xp22.2
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary Gastrin-releasing peptide (GRP) regulates numerous functions of the gastrointestinal and central nervous systems, including release of gastrointestinal hormones, smooth muscle cell contraction, and epithelial cell proliferation and is a potent mitogen for neoplastic tissues. The effects of GRP are mediated through the gastrin-releasing peptide receptor. This receptor is a glycosylated, 7-transmembrane G-protein coupled receptor that activates the phospholipase C signaling pathway. The receptor is aberrantly expressed in numerous cancers such as those of the lung, colon, and prostate. An individual with autism and multiple exostoses was found to have a balanced translocation between chromosome 8 and a chromosome X breakpoint located within the gastrin-releasing peptide receptor gene. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.