VEGFC (NM_005429) Human Untagged Clone

CAT#: SC116730

Reviews ()
Write a review

VEGFC (untagged)-Human vascular endothelial growth factor C (VEGFC)



  "NM_005429" in other vectors (6)

USD 433.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name VEGFC (NM_005429) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol VEGFC
Synonyms Flt4-L; LMPH1D; LMPHM4; VRP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_005429 edited
GGCACCAGGGGAGAGGGACCAGGAGGGGCCCGCGGCCTCGCAGGGGCGCCCGCGCCCCCA
CCCCTGCCCCCGCCAGCGGACCGGTCCCCCACCCCCGGTCCTTCCACCATGCACTTGCTG
GGCTTCTTCTCTGTGGCGTGTTCTCTGCTCGCCGCTGCGCTGCTCCCGGGTCCTCGCGAG
GCGCCCGCCGCCGCCGCCGCCTTCGAGTCCGGACTCGACCTCTCGGACGCGGAGCCCGAC
GCGGGCGAGGCCACGGCTTATGCAAGCAAAGATCTGGAGGAGCAGTTACGGTCTGTGTCC
AGTGTAGATGAACTCATGACTGTACTCTACCCAGAATATTGGAAAATGTACAAGTGTCAG
CTAAGGAAAGGAGGCTGGCAACATAACAGAGAACAGGCCAACCTCAACTCAAGGACAGAA
GAGACTATAAAATTTGCTGCAGCACATTATAATACAGAGATCTTGAAAAGTATTGATAAT
GAGTGGAGAAAGACTCAATGCATGCCACGGGAGGTGTGTATAGATGTGGGGAAGGAGTTT
GGAGTCGCGACAAACACCTTCTTTAAACCTCCATGTGTGTCCGTCTACAGATGTGGGGGT
TGCTGCAATAGTGAGGGGCTGCAGTGCATGAACACCAGCACGAGCTACCTCAGCAAGACG
TTATTTGAAATTACAGTGCCTCTCTCTCAAGGCCCCAAACCAGTAACAATCAGTTTTGCC
AATCACACTTCCTGCCGATGCATGTCTAAACTGGATGTTTACAGACAAGTTCATTCCATT
ATTAGACGTTCCCTGCCAGCAACACTACCACAGTGTCAGGCAGCGAACAAGACCTGCCCC
ACCAATTACATGTGGAATAATCACATCTGCAGATGCCTGGCTCAGGAAGATTTTATGTTT
TCCTCGGATGCTGGAGATGACTCAACAGATGGATTCCATGACATCTGTGGACCAAACAAG
GAGCTGGATGAAGAGACCTGTCAGTGTGTCTGCAGAGCGGGGCTTCGGCCTGCCAGCTGT
GGACCCCACAAAGAACTAGACAGAAACTCATGCCAGTGTGTCTGTAAAAACAAACTCTTC
CCCAGCCAATGTGGGGCCAACCGAGAATTTGATGAAAACACATGCCAGTGTGTATGTAAA
AGAACCTGCCCCAGAAATCAACCCCTAAATCCTGGAAAATGTGCCTGTGAATGTACAGAA
AGTCCACAGAAATGCTTGTTAAAAGGAAAGAAGTTCCACCACCAAACATGCAGCTGTTAC
AGACGGCCATGTACGAACCGCCAGAAGGCTTGTGAGCCAGGATTTTCATATAGTGAAGAA
GTGTGTCGTTGTGTCCCTTCATATTGGAAAAGACCACAAATGAGCTAAGATTGTACTGTT
TTCCAGTTCATCGATTTTCTATTATGGAAAACTGTGTTGCCACAGTAGAACTGTCTGTGA
ACAGAGAGACCCTTGTGGGTCCATGCTAACAAAGACAAAAGTCTGTCTTTCCTGAACCAT
GTGGATAACTTTACAGAAATGGACTGGAGCTCATCTGCAAAAGGCCTCTTGTAAAGACTG
GTTTTCTGCCAATGACCAAACAGCCAAGATTTTCCTCTTGTGATTTCTTTAAAAGAATGA
CTATATAATTTATTTCCACTAAAAATATTGTTTCTGCATTCATTTTTATAGCAACAACAA
TTGGTAAAACTCACTGTGATCAATATTTTTATATCATGCAAAATATGTTTAAAATAAAAT
GAAAATTGTATTAT
>OriGene 5' read for NM_005429 unedited
GATTTTGGTATACGACTCACTATAGGGCGGCCGCGAATTCGGCACCAGGGGNAAAGGGAC
CAGGAGGGGCCCGCGGCCTCGCAGGGGCGCCCGCGCCCCCACCCCTGCCCCCGCCAGCGG
ACCGGTCCCCCACCCCCGGTCCTTCCACCATGCACTTGCTGGGCTTCTTCTCTGTGGCGT
GTTCTCTGCTCGCCGCTGCGCTGCTCCCGGGTCCTCGCGAGGCGCCCGCCGCCGCCGCCG
CCTTCGAGTCCGGACTCGACCTCTCGGACGCGGAGCCCGACGCGGGCGAGGCCACGGCTT
ATGCAAGCAAAGATCTGGAGGAGCAGTTACGGTCTGTGTCCAGTGTAGATGAACTCATGA
CTGTACTCTACCCAGAATATTGGAAAATGTACAAGTGTCAGCTAAGGAAAGGAGGCTGGC
AACATAACAGAGAACAGGCCAACCTCAACTCAAGGACAGAAGAGACTATAAAATTTGCTG
CAGCACATTATAATACAGAGATCTTGAAAAGTATTGATAATGAGTGGAGAAAGACTCAAT
GCATGCCACGGGAGGTGTGTATAGATGTGGGGAAGGAGTTTGGAGTCGCGACAAACACCT
TCTTTAAACCTCCATGTGTGTCCGTCTACAGATGTGGNGGTTGCTGCAATAGTGAGGGGC
TGCAGTGCATGAACACCAGCACGAGCTACCTCAGNCAGACGTTATTTGAAATTACAGTGC
CTCTCTCTCAGGGCCCANACCAGTANNNCATCAGTTTGCCAATCACACTTCCTGCCGATG
CATGTCTAACTGGATGNTACAGACAGNTCATTNCATATTAGACCGTCCTGNCAGCACACT
ACCCAGTGTCAGGCAGCGACAAGACTGCCCCACATTACATGGGATAATACTCTGCCGAGC
CTGCTCAGAGAATTATTTTTCCTCGAGCTGAGAGACCACAGAGGATCCTGACTCGTGACA
Restriction Sites NotI-NotI     
ACCN NM_005429
Insert Size 1900 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005429.2, NP_005420.1
RefSeq Size 2076 bp
RefSeq ORF 1260 bp
Locus ID 7424
Cytogenetics 4q34.3
Domains PDGF, CXCXC
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Bladder cancer, Cytokine-cytokine receptor interaction, Focal adhesion, mTOR signaling pathway, Pancreatic cancer, Pathways in cancer, Renal cell carcinoma
Gene Summary The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. The encoded protein promotes angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. The proprotein is further cleaved into a fully processed form that can bind and activate VEGFR-2 and VEGFR-3 receptors. [provided by RefSeq, Apr 2014]

Other Versions

Other products for "VEGFC"
Frequently bought together (2)
VEGFC mouse monoclonal antibody, clone OTI4A1 (formerly 4A1)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools