Synaptotagmin 1(SYT1) (NM_005639) Human Untagged Clone

CAT#: SC116605

SYT1 (untagged)-Human synaptotagmin I (SYT1), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Synaptotagmin 1(SYT1) (NM_005639) Human Untagged Clone
Symbol SYT1
Synonyms P65; SVP65; SYT
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC116605 sequence for NM_005639 edited (data generated by NextGen Sequencing)
ATGGTGAGCGAGAGTCACCATGAGGCCCTGGCAGCCCCGCCTGTCACCACTGTCGCGACT
GTTCTGCCAAGCAATGCCACAGAGCCAGCCAGTCCTGGAGAAGGAAAGGAAGATGCATTT
TCTAAGCTGAAGGAGAAGTTTATGAATGAGTTGCATAAAATTCCATTGCCACCGTGGGCC
TTAATTGCAATAGCCATAGTCGCAGTCCTTTTAGTCCTGACCTGCTGCTTTTGTATCTGT
AAGAAATGTTTGTTCAAAAAGAAAAACAAGAAGAAGGGAAAGGAAAAAGGAGGGAAGAAT
GCCATTAACATGAAAGATGTAAAAGACTTAGGGAAGACGATGAAAGATCAGGCCCTCAAG
GATGATGATGCTGAAACTGGATTGACAGATGGAGAAGAAAAAGAAGAACCCAAAGAAGAG
GAGAAACTGGGAAAACTTCAGTATTCACTGGATTATGATTTCCAAAATAACCAGCTGCTG
GTAGGGATCATTCAGGCTGCCGAACTGCCCGCCTTGGACATGGGGGGCACATCTGATCCT
TACGTGAAAGTGTTTCTGCTACCTGATAAGAAGAAGAAATTTGAGACAAAAGTCCACCGA
AAAACCCTTAATCCTGTCTTCAATGAGCAATTTACTTTCAAGGTACCATACTCGGAATTG
GGTGGCAAAACCCTAGTGATGGCTGTATATGATTTTGATCGTTTCTCTAAGCATGACATC
ATTGGAGAATTTAAAGTCCCTATGAACACAGTGGATTTTGGCCATGTAACTGAGGAATGG
CGTGACCTGCAAAGTGCTGAGAAGGAAGAGCAAGAGAAATTGGGTGATATCTGCTTCTCC
CTTCGCTACGTACCTACTGCTGGTAAGCTGACTGTTGTCATTCTGGAGGCAAAGAACCTG
AAGAAGATGGATGTGGGTGGCTTATCCGATCCTTATGTGAAGATTCATCTGATGCAGAAT
GGTAAGAGGCTGAAGAAGAAAAAGACAACAATTAAAAAGAACACACTTAACCCCTACTAC
AATGAGTCATTCAGCTTTGAAGTACCTTTTGAACAAATCCAGAAAGTGCAGGTGGTGGTA
ACTGTTTTGGACTATGACAAGATTGGCAAGAACGATGCCATCGGCAAAGTCTTTGTGGGC
TACAACAGCACCGGCGCGGAGCTGCGACACTGGTCAGACATGCTGGCCAACCCCAGGCGA
CCTATTGCCCAGTGGCACACCCTGCAGGTAGAGGAGGAAGTTGATGCCATGCTGGCCGTC
AAGAAGTAA

Clone variation with respect to NM_005639.2
75 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005639 unedited
GTATGATTTGTAACCGACTTCTATAGGCGGCCGCGAAATTCGCACGAGGCCGGCACCACC
TCCCGGTCCGCCCTCCAGGGNAAAACGGGNAAAACTAGCAAGAGCTAGCAAGAACTAGCA
AGAGCTTGAACAAACGCCTGGACTCAGATTGGAAGACTGCTCATTTGTCTACTGCCTCAT
TCCTGGAAATTGCACTGGAACTGTCTGATTATAGAAAAACAGAATAATTCTGAAAGAAAG
AAAACAAAGAAAAACATACTCCAGAATTCCTAATAGAACACTTCACCTGAACCTAAAATG
GTGAGCGAGAGTCACCATGAGGCCCTGGCAGCCCCGCCTGTCACCACTGTCGCGACTGTT
CTGCCAAGCAATGCCACAGAGCCAGCCAGTCCTGGAGAAGGAAAGGAAGATGCATTTTCT
AAGCTGAAGGAGAAGTTTATGAATGAGTTGCATAAAATTCCATTGCCACCGTGGGCCTTA
ATTGCAATAGCCATAGTCGCAGTCCTTTTAGTCCTGACCTGCTGCTTTTGTATCTGTAAG
AAATGTTTGTTCAAAAAGAAAAACAAGAAGAAGGGAAAGGAAAAAGGAGGGAAGAATGCC
ATTAACATGAAAGATGTAAAAGACTTANGGAAGACGATGAAAGATCANGCCCTCAAGGAT
GATGATGCTGAAACTGGATTGACAGATGGAGAANAANAAAGAAGACCCCAAGNNAGAGAG
AAACTGGGAAAACTCAGTATTCACTGGATTATGATTTCCAAAATAACCAGCTGCTGTTAG
GGATCATTCANGCTGCCGAACTGCCCGCCTTGGCATGGNGGGGCACATCTGATTCTTACG
TGAAAAGGTTCCTGCTACCTGATTAGAAGAAGAAAATTGAGACAAAAGTCCACCGAAAAC
CCTTAATCTGTCTTCATGAGCAATTTACTTTAAG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005639 unedited
TGATGGGATACAANNTACTGGTNNCTNGNTNTNNTNNACCACAAGAGTAATTTTGTGTAA
TAAGCACAGATTGTTGTGTTAAAAATATCCTGCATTCCTTCTAACCTGGTTTTATAATTA
ATAAAATATTTTGTTACAAACTCTAATGTGCAAACCTTTTTGGGAATTATTGTANGTGTG
ATAAAAAATTTTTCTTTTGAACAGAAATTTACCAGGATGTACATTTTNNNNTNTNGNTTA
TAAAGGTGAATATNNNTGGGGGGGGAGGACCTACTTTNNNNNNNNNNCCCCCCTTTTTTT
TTTTTTNAAAAAAAAGCCCGGCCAATTTTTCTATAAAGGTTAACTTTTTCCCCCTAAACT
TTTTTTTCCCCCATCCCCAAAAAAAATGGCCCCAANANAANAAAAANNAAAACCCNNNAC
ACCNCCGGGAAACCCTTGGGGGTTTTTCTTTTGCCGGAAATTTGAAAACTTTGCCCCCCG
TGTAAAGGGCTTTCCTCAAATTAAAAAGGGACCCCCTTTTTTAACCTTTGGAAAATTTGC
CCCAACAGGGGCTATTTTGGTTTTGGGGCTTTCCTTCTTGAGGGCAACCCTGATGCCGCT
GCTAAAACAATGCTTTTTGCCTGGGAGGGAATTCACAAAATTGGATTCCCCCCCAGTTTG
GGGGGGAAGTTAATCTTGGACTCAAATGAATCAATAAAAGCCTAGGTTTAATTGCCCTTA
AAATTGCAATTAACCGGCCTTAGGCCTACCAGTGGATATTTTTGCTGGAAGCCAACAAAC
TTTTTTCCCGTATAATTTTATTACCTTCCTTTTCTTAAGCATTTACTAGGTAAAAAAAAA
ATTTTTTTTAAACCTTTTATATCCCCCTTTTGGAACCCCTTCCCATTCCATTCCCACACC
TAAAAAACTTTTGCCCCCCGGTTAACCCAGGGGGACCACAAAAAATTTCTTTTGGCCTCT
TCCCACCCATATTGGTAAAAAAAAAATTATTTGGGGGCCCGGTTTATAAGAAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005639
ORF Size 1269 bp
Insert Size 2770
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005639.1, NP_005630
RefSeq Size 3244
Locus ID 6857
Cytogenetics 12q21.2
Domains C2
Protein Families Secreted Protein, Transmembrane
Gene Summary The synaptotagmins are integral membrane proteins of synaptic vesicles thought to serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Calcium binding to synaptotagmin-1 participates in triggering neurotransmitter release at the synapse (Fernandez-Chacon et al., 2001 [PubMed 11242035]).[supplied by OMIM, Jul 2010].
Transcript Variant: This variant (1) encodes isoform 1. Variants 1, 2, and 3 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.