ASK1(MAP3K5) (NM_005923) Human Untagged Clone

CAT#: SC116450

MAP3K5 (untagged)-Human mitogen-activated protein kinase kinase kinase 5 (MAP3K5)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ASK1(MAP3K5) (NM_005923) Human Untagged Clone
Symbol MAP3K5
Synonyms ASK1; MAPKKK5; MEKK5
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_005923 edited
ATGAGCACGGAGGCGGACGAGGGCATCACTTTCTCTGTGCCACCCTTCGCCCCCTCGGGC
TTCTGCACCATCCCCGAGGGCGGCATCTGCAGGAGGGGAGGAGCGGCGGCGGTGGGCGAG
GGCGAGGAGCACCAGCTGCCACCGCCGCCGCCGGGCAGCTTCTGGAACGTGGAGAGCGCC
GCTGCCCCTGGCATCGGTTGTCCGGCGGCCACCTCCTCGAGCAGTGCCACCCGAGGCCGG
GGCAGCTCTGTTGGCGGGGGCAGCCGACGGACCACGGTGGCATATGTGATCAACGAAGCG
AGCCAAGGGCAACTGGTGGTGGCCGAGAGCGAGGCCCTGCAGAGCTTGCGGGAGGCGTGC
GAGACAGTGGGCGCCACCCTGGAAACCCTGCATTTTGGGAAACTCGACTTTGGAGAAACC
ACCGTGCTGGACCGCTTTTACAATGCAGATATTGCGGTGGTGGAGATGAGCGATGCCTTC
CGGCAGCCGTCCTTGTTTTACCACCTTGGGGTGAGAGAAAGTTTCAGCATGGCCAACAAC
ATCATCCTCTACTGTGATACTAACTCGGACTCTCTGCAGTCACTGAAGGAAATAATTTGC
CAGAAGAATACTATGTGCACTGGGAACTACACCTTTGTTCCTTACATGATAACTCCACAT
AACAAAGTCTACTGCTGTGACAGCAGCTTCATGAAGGGGTTGACAGAGCTCATGCAACCG
AACTTCGAGCTGCTTCTTGGACCCATCTGCTTACCTCTTGTGGATCGTTTTATTCAACTT
TTGAAGGTGGCACAAGCAAGTTCTAGCCAGTACTTCCGGGAATCTATACTCAATGACATC
AGGAAAGCTCGTAATTTATACACTGGTAAAGAATTGGCAGCTGAGTTGGCAAGAATTCGG
CAGCGAGTAGATAATATCGAAGTCTTGACAGCAGATATTGTCATAAATCTGTTACTTTCC
TACAGAGATATCCAGGACTATGATTCTATTGTGAAGCTGGTAGAGACTTTAGAAAAACTG
CCAACCTTTGATTTGGCCTCCCATCACCATGTGAAGTTTCATTATGCATTTGCACTGAAT
AGGAGAAATCTCCCTGGTGACAGAGCAAAAGCTCTTGATATTATGATTCCCATGGTGCAA
AGCGAAGGACAAGTTGCTTCAGATATGTATTGCCTAGTTGGTCGAATCTACAAAGATATG
TTTTTGGACTCTAATTTCACGGACACTGAAAGCAGAGACCATGGAGCTTCTTGGTTCAAA
AAGGCATTTGAATCTGAGCCAACACTACAGTCAGGAATTAATTATGCGGTCCTCCTCCTG
GCAGCTGGACACCAGTTTGAATCTTCCTTTGAGCTCCGGAAAGTTGGGGTGAAGCTAAGT
AGTCTTCTTGGTAAAAAGGGAAACTTGGAAAAACTCCAGAGCTACTGGGAAGTTGGATTT
TTTCTGGGGGCCAGCGTCCTAGCCAATGACCACATGAGAGTCATTCAAGCATCTGAAAAG
CTTTTTAAACTGAAGACACCAGCATGGTACCTCAAGTCTATTGTAGAGACAATTTTGATA
TATAAGCATTTTGTGAAACTGACCACAGAACAGCCTGTGGCCAAGCAAGAACTTGTGGAC
TTTTGGATGGATTTCCTGGTCGAGGCCACAAAGACAGATGTTACTGTGGTTAGGTTTCCA
GTATTAATATTAGAACCAACCAAAATCTATCAACCTTCTTATTTGTCTATCAACAATGAA
GTTGAGGAAAAGACAATCTCTATTTGGCACGTGCTTCCTGATGACAAGAAAGGTATACAT
GAGTGGAATTTTAGTGCCTCTTCTGTCAGGGGAGTGAGTATTTCTAAATTTGAAGAAAGA
TGCTGCTTTCTTTATGTGCTTCACAATTCTGATGATTTCCAAATCTATTTCTGTACAGAA
CTTCATTGTAAAAAGTTTTTTGAGATGGTGAACACCATTACCGAAGAGAAGGGGAGAAGC
ACAGAGGAAGGAGACTGTGAAAGTGACTTGCTGGAGTATGACTATGAATATGATGAAAAT
GGTGACAGAGTCGTTTTAGGAAAAGGCACTTATGGGATAGTCTACGCAGGTCGGGACTTG
AGCAACCAAGTCAGAATTGCTATTAAGGAAATCCCAGAGAGAGACAGCAGATACTCTCAG
CCCCTGCATGAAGAAATAGCATTGCATAAACACCTGAAGCACAAAAATATTGTCCAGTAT
CTGGGCTCTTTCAGTGAGAATGGTTTCATTAAAATCTTCATGGAGCAGGTCCCTGGAGGA
AGTCTTTCTGCTCTCCTTCGTTCCAAATGGGGTCCATTAAAAGACAATGAGCAAACAATT
GGCTTTTATACAAAGCAAATACTGGAAGGATTAAAATATCTCCATGACAATCAGATAGTT
CACCGGGACATAAAGGGTGACAATGTGTTGATTAATACCTACAGTGGTGTTCTCAAGATC
TCTGACTTCGGAACATCAAAGAGGCTTGCTGGCATAAACCCCTGTACTGAAACTTTTACT
GGTACCCTCCAGTATATGGCACCAGAAATAATAGATAAAGGACCAAGAGGCTACGGAAAA
GCAGCAGACATCTGGTCTCTGGGCTGTACAATCATTGAAATGGCCACAGGAAAACCCCCA
TTTTATGAACTGGGAGAACCACAAGCAGCTATGTTCAAGGTGGGAATGTTTAAAGTCCAC
CCTGAGATCCCAGAGTCCATGTCTGCAGAGGCCAAGGCATTCATACTGAAATGTTTTGAA
CCAGATCCTGACAAGAGAGCCTGTGCTAACGACTTGCTTGTTGATGAGTTTTTAAAAGTT
TCAAGCAAAAAGAAAAAGACACAACCTAAGCTTTCAGCTCTTTCAGCTGGATCAAATGAA
TATCTCAGGAGTATATCCTTGCCGGTACCTGTGCTGGTGGAGGACACCAGCAGCAGCAGT
GAGTACGGCTCAGTTTCACCCGACACGGAGTTGAAAGTGGACCCCTTCTCTTTCAAAACA
AGAGCCAAGTCCTGCGGAGAAAGAGATGTCAAGGGAATTCGGACACTCTTTTTGGGCATT
CCAGATGAGAATTTTGAAGATCACAGTGCTCCTCCTTCCCCTGAAGAAAAAGATTCTGGA
TTCTTCATGCTGAGGAAGGACAGTGAGAGGCGAGCTACCCTTCACAGGATCCTGACGGAA
GACCAAGACAAAATTGTGAGAAACCTAATGGAATCTTTAGCTCAGGGGGCTGAAGAACCG
AAACTAAAATGGGAACACATCACAACCCTCATTGCAAGCCTCAGAGAATTTGTGAGATCC
ACTGACCGAAAAATCATAGCCACCACACTGTCAAAGCTGAAACTGGAGCTGGACTTCGAC
AGCCATGGCATTAGCCAAGTCCAGGTGGTACTCTTTGGTTTTCAAGATGCTGTCAATAAA
GTTCTTCGGAATCATAACATCAAGCCGCACTGGATGTTTGCCTTAGACAGTATCATTCGG
AAGGCGGTACAGACAGCCATTACCATCCTGGTTCCAGAACTAAGGCCACATTTCAGCCTT
GCATCTGAGAGTGATACTGCTGATCAAGAAGACTTGGATGTAGAAGATGACCATGAGGAA
CAGCCTTCAAATCAAACTGTCCGAAGACCTCAGGCTGTCATTGAAGATGCTGTGGCTACC
TCAGGCGTGAGCACGCTCAGTTCTACTGTGTCTCATGATTCCCAGAGTGCTCACCGGTCA
CTGAATGTACAGCTTGGAAGGATGAAAATAGAAACCAATAGATTACTGGAAGAATTGGTT
CGGAAAGAGAAAGAATTACAAGCACTCCTTCATCGAGCTATTGAAGAAAAAGACCAAGAA
ATTAAACACCTGAAGCTTAAGTCCCAACCCATAGAAATTCCTGAATTGCCTGTATTTCAT
CTAAATTCTTCTGGCACAAATACTGAAGATTCTGAACTTACCGACTGGCTGAGAGTGAAT
GGAGCTGATGAAGACACTATAAGCCGGTTTTTGGCTGAAGATTATACACTATTGGATGTT
CTCTACTATGTTACACGTGATGACTTAAAATGCTTGAGACTAAGGGGAGGGATGCTGTGC
ACACTGTGGAAGGCTATCATTGACTTTCGAAACAAACAGACTTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005923 unedited
GGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTGTTAGTGAACCGTCA
GAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACCAGGCGCGGCGGGT
GGCGAGGGCGGGCTGCACCCCGAGCGCGGCGCCCTTGAGCTGCACCGCGGCGCAGGTTTG
CGAGCCGACTTGTCAGCCGGCCAAGAAAAGGAAGCTCCGTCCCTTCCCGCTCACCCGGCT
TCCCCACCCCTTGTACTCTAAACTCTGCAGAGGGCGAGCGGCGCGGCCACGGAGGCGCCG
AGGAGGAGCGAGCCGCCGCCGGGCAGCGGCGTGCCCTCGGGGGAGAGGGCGCCGGAGAGG
AGGCGGCGGCGCGGCGGCGAGGGCGCGGCGCGCGATGGCAGCTGCTTAGCCCGGCGGGCG
CGGAGCAG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005923 unedited
ACCTTGGTATCNCGACCCGTCCNGCTTCNGNNANNCAANNNNAGGCCCTTTTTTTTTTAA
CATGAGTATTTTATACTGGATTTAAAGTGCAGCGCCCTTCTCCTCTCCCTTCGATTTTCC
CACCCCCAAGAAGACAGCTCTGTATTAATTTTTACAATTTCCATCGAATATTATATTGAG
CACCATTCAAGTCTGTTTGTTTCGAAAGACAAAGATTTCCTTCCACTTTGNGCACAGCAN
CCCTTCTCTTAGTCTCAAGCATTTTAAGTCATCACGTGTAACATAGTACAGAACATCCAA
TAGTGTATAATCTTCACCCAAAAACCGGCTTATAGCGTCTTCATCACCTCCATTCACCCT
CAGCCAGCCGGTAAGTCCACAATCCTCCCCCTTCCTCCCCCACNACTTCACATGAAACAC
ACGCAATTCAGGAATCTCTATCGCCCGGCCCTTAACCTCCACGCGCTCAATTCCCCGGCC
TCCCCCTTCANTANCTTTCCAACGGATTGCTCTGCCCTCTTTCTCTCCCCCAACCAATTC
TTCCCACCATCTACCTCCCCCTACTCCCCCCCCTCCACCCCTTCCCTTCCTCTCCCCCCC
CCCCCCTCCTCGCTACTCCTGCACCACCCTCCCATCTCCCCTCCTCCTCCCCCCCACCCT
CCCCCTCTCTCTCCTACCCCCCTCCTTCCCCTCCTCCCCCCCCCCTCCCTTCCGCTCCCC
CCTTACNNCCCCCCNTTCCCCCTCCCCCCCCCCTGTACCCCCTACCCCCCCCCGCCCCCC
CCCCCTCCCTCCCCCCCTTTTTTCCCCTCCCTTTTCTCCCTCCCTTCCCCCCCCCCCCCT
CCCCCCCTTCCCCCCCTCCTTTTCCCTCCCCCCCCTACTCTCCCTCTTATCCGCCCCCTC
CTCCCCCCCTTCCCCTTCCCTTCCCCCCCTCCTCGCCCCCTCCCCCCCCCCCCGCACTGT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005923
ORF Size 4125 bp
Insert Size 4700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005923.3, NP_005914
RefSeq Size 5215
Locus ID 4217
Cytogenetics 6q23.3
Domains pkinase, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways MAPK signaling pathway, Neurotrophin signaling pathway, Amyotrophic lateral sclerosis (ALS)
Gene Summary Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.