MDH1 (NM_005917) Human Untagged Clone

CAT#: SC116447

MDH1 (untagged)-Human malate dehydrogenase 1, NAD (soluble) (MDH1), transcript variant 2

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MDH1 (NM_005917) Human Untagged Clone
Symbol MDH1
Synonyms HEL-S-32; MDH-s; MDHA; MGC:1375; MOR2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC116447 sequence for NM_005917 edited (data generated by NextGen Sequencing)
ATGTCTGAACCAATCAGAGTCCTTGTGACTGGAGCAGCTGGTCAAATTGCATATTCACTG
CTGTACAGTATTGGAAATGGATCTGTCTTTGGTAAAGATCAGCCTATAATTCTTGTGCTG
TTGGATATCACCCCCATGATGGGTGTCCTGGACGGTGTCCTAATGGAACTGCAAGACTGT
GCCCTTCCCCTCCTGAAAGATGTCATCGCAACAGATAAAGAAGACGTTGCCTTCAAAGAC
CTGGATGTGGCCATTCTTGTGGGCTCCATGCCAAGAAGGGAAGGCATGGAGAGAAAAGAT
TTACTGAAAGCAAATGTGAAAATCTTCAAATCCCAGGGTGCAGCCTTAGATAAATACGCC
AAGAAGTCAGTTAAGGTTATTGTTGTGGGTAATCCAGCCAATACCAACTGCCTGACTGCT
TCCAAGTCAGCTCCATCCATCCCCAAGGAGAACTTCAGTTGCTTGACTCGTTTGGATCAC
AACCGAGCTAAAGCTCAAATTGCTCTTAAACTTGGTGTGACTGCTAATGATGTAAAGAAT
GTCATTATCTGGGGAAACCATTCCTCGACTCAGTATCCAGATGTCAACCATGCCAAGGTG
AAATTGCAAGGAAAGGAAGTTGGTGTTTATGAAGCTCTGAAAGATGACAGCTGGCTCAAG
GGAGAATTTGTCACGACTGTGCAGCAGCGTGGCGCTGCTGTCATCAAGGCTCGAAAACTA
TCCAGTGCCATGTCTGCTGCAAAAGCCATCTGTGACCACGTCAGGGACATCTGGTTTGGA
ACCCCAGAGGGAGAGTTTGTGTCCATGGGTGTTATCTCTGATGGCAACTCCTATGGTGTT
CCTGATGATCTGCTCTACTCATTCCCTGTTGTAATCAAGAATAAGACCTGGAAGTTTGTT
GAAGGTCTCCCTATTAATGATTTCTCACGTGAGAAGATGGATCTTACTGCAAAGGAACTG
ACAGAAGAAAAAGAAAGTGCTTTTGAATTTCTTTCCTCTGCCTGA

Clone variation with respect to NM_005917.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005917 unedited
TACGACTCCTATAGGCGGCCCGCGAATTCGCACGAGGCGGTAGAGGTGACCTGACTCTCT
GAGGCTCATTTTGCAGTTGTTGAAATTGTCCCCGCAGTTTTCAATCATGTCTGAACCAAT
CAGAGTCCTTGTGACTGGAGCAGCTGGTCAAATTGCATATTCACTGCTGTACAGTATTGG
AAATGGATCTGTCTTTGGTAAAGATCAGCCTATAATTCTTGTGCTGTTGGATATCACCCC
CATGATGGGTGTCCTGGACGGTGTCCTAATGGAACTGCAAGACTGTGCCCTTCCCCTCCT
GAAAGATGTCATCGCAACAGATAAAGAAGACGTTGCCTTCAAAGACCTGGATGTGGCCAT
TCTTGTGGGCTCCATGCCAAGAAGGGAAGGCATGGAGAGAAAAGATTTACTGAAAGCAAA
TGTGAAAATCTTCAAATCCCAGGGTGCAGCCTTAGATAAATACGCCAAGAAGTCAGTTAA
GGTTATTGTTGTGGGTAATCCAGCCAATACCAACTGCCTGACTGCTTCCAAGTCAGCTCC
ATCCATCCCCAAGGAGAACTTCAGTTGCTTGACTCGTTTGGATCACAACCGAGCTAAAGC
TCANATTGCTCTTAAACTTGGTGTGACTGCTAATGATGTAAAGAATGTCATTATCTGGNG
AAACCATTCCTCGACTCAGTATCCAGATGTCAACCATGCCAAGGGTGAAATTGCAAGGAA
AGGAAGNNTGGTGTTTATGAAAGCTCTGAAAGATGACAGCTGGCTCAAGGGAGATTTGTC
ACGACTGTGCAGCAGCGTGGCGCTTCTGTCATCAAGGCTCGAAACTATCCATGCCATGTC
TGCTGCAAAGCCATCTGTGACACGTCAGGGACATCTGGTTNGGGACCCAAGGAAGAGTTT
GGTCATGGGTGTATCTCTGAGGCACTCCTAGGNGTCCTGAGAACTGCCTACTCATCCTGT
GTATCAGATAGACCTGGAGTTGGTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005917 unedited
GCAACTTTCCAGGGCCAGGAATAGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGATC
TGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTT
TTCACTTTCATTTGAATATATATTTATTTAGAATGCACACTAACAGCATGACGATAAACT
GTCATTCACAAACCTGTACCAAGAAGCACGTAATCTTTAAAATGTGTTGTTTTTCACAAG
TAATTTAAGTATAGCATTATTATTATTTGGTACTTGAGTCAAAGACGACATTTAGATTCT
TCAGCTTTGAAGCATTTAGTAACATCATTGTCTAGTCAGGCAGAGGAAAGAAATTCAAAA
GCACTTTCTTTTTCTTCTGTCAGTTCCTTTGCAGTAAGATCCATCTTCTCACGTGAGAAA
TCATTAATAGGGAGACCTTCAACAAACTTCCAGGTCTTATTCTTGATTACAACAGGGAAT
GAGTAGAGCAGATCATCAGGAACACCATAGGAGTTGCCATCAGAGATAACACCCATGGAC
ACAAACTCTCCCTCTGGGGTTCCAAACCAGATGTCCCTGACGTGGTCACAGATGGCTTTT
GCAGCAGACATGGCACTGGATAGTTTTCGAGCCTTGATGACAGCAGCGCCACGCTGCTGC
ACAGTCGTGACAAATTCTCCCTTGAGCCAGCTGTCATCTTTCAGAGCTTCATAACACCAA
CTTCCTTTCCTTGCATTTTCACCTTGGCATGGTTGACATCTGGATACTGAGTCGAGAAAT
GGTTTCCCCAGATATGACATTCTTTACATCATAACAGNCACACAAGTTTAGAGCTTTTGA
GCTTACCTCGGTTGGGATCCAACGAGTCAGCAACTGAGTTCTCCTTGGGGATGAAGGAGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005917
ORF Size 1005 bp
Insert Size 1370
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005917.2, NP_005908
RefSeq Size 1268
RefSeq ORF 1005
Locus ID 4190
Cytogenetics 2p15
Domains ldh
Protein Families Druggable Genome
Protein Pathways Citrate cycle (TCA cycle), Pyruvate metabolism, Glyoxylate and dicarboxylate metabolism, Metabolic pathways
Gene Summary This gene encodes an enzyme that catalyzes the NAD/NADH-dependent, reversible oxidation of malate to oxaloacetate in many metabolic pathways, including the citric acid cycle. Two main isozymes are known to exist in eukaryotic cells: one is found in the mitochondrial matrix and the other in the cytoplasm. This gene encodes the cytosolic isozyme, which plays a key role in the malate-aspartate shuttle that allows malate to pass through the mitochondrial membrane to be transformed into oxaloacetate for further cellular processes. Alternatively spliced transcript variants have been found for this gene. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Pseudogenes have been identified on chromosomes X and 6. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (2) has an alternate 5' exon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations