PRMT5 (NM_006109) Human Untagged Clone

CAT#: SC116333

PRMT5 (untagged)-Human protein arginine methyltransferase 5 (PRMT5), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PRMT5 (NM_006109) Human Untagged Clone
Symbol PRMT5
Synonyms HRMT1L5; IBP72; JBP1; SKB1; SKB1Hs
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006109, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGATGGCGGTCGGGGGTGCTGGTGGGAGCCGCGTGTCCAGCGGGAGGGACCTGAATTGCGTCC
CCGAAATAGCTGACACACTAGGGGCTGTGGCCAAGCAGGGGTTTGATTTCCTCTGCATGCCTGTCTTCCA
TCCGCGTTTCAAGAGGGAGTTCATTCAGGAACCTGCTAAGAATCGGCCCGGTCCCCAGACACGATCAGAC
CTACTGCTGTCAGGAAGGGACTGGAATACGCTAATTGTGGGAAAGCTTTCTCCATGGATTCGTCCAGACT
CAAAAGTGGAGAAGATTCGCAGGAACTCCGAGGCGGCCATGTTACAGGAGCTGAATTTTGGTGCATATTT
GGGTCTTCCAGCTTTCCTGCTGCCCCTTAATCAGGAAGATAACACCAACCTGGCCAGAGTTTTGACCAAC
CACATCCACACTGGCCATCACTCTTCCATGTTCTGGATGCGGGTACCCTTGGTGGCACCAGAGGACCTGA
GAGATGATATAATTGAGAATGCACCAACTACACACACAGAGGAGTACAGTGGGGAGGAGAAAACGTGGAT
GTGGTGGCACAACTTCCGGACTTTGTGTGACTATAGTAAGAGGATTGCAGTGGCTCTTGAAATTGGGGCT
GACCTCCCATCTAATCATGTCATTGATCGCTGGCTTGGGGAGCCCATCAAAGCAGCCATTCTCCCCACTA
GCATTTTCCTGACCAATAAGAAGGGATTTCCTGTTCTTTCTAAGATGCACCAGAGGCTCATCTTCCGGCT
CCTCAAGTTGGAGGTGCAGTTCATCATCACAGGCACCAACCACCACTCAGAGAAGGAGTTCTGCTCCTAC
CTCCAATACCTGGAATACTTAAGCCAGAACCGTCCTCCACCTAATGCCTATGAACTCTTTGCCAAGGGCT
ATGAAGACTATCTGCAGTCCCCGCTTCAGCCACTGATGGACAATCTGGAATCTCAGACATATGAAGTGTT
TGAAAAGGACCCCATCAAATACTCTCAGTACCAGCAGGCCATCTATAAATGTCTGCTAGACCGAGTACCA
GAAGAGGAGAAGGATACCAATGTCCAGGTACTGATGGTGCTGGGAGCAGGACGGGGACCCCTGGTGAACG
CTTCCCTGCGGGCAGCCAAGCAGGCCGACCGGCGGATAAAGCTGTATGCTGTGGAGAAAAACCCAAATGC
CGTGGTGACGCTAGAGAACTGGCAGTTTGAAGAATGGGGAAGCCAAGTGACCGTAGTCTCATCAGACATG
AGGGAATGGGTGGCTCCAGAGAAAGCAGACATCATTGTCAGTGAGCTTCTGGGCTCATTTGCTGACAATG
AATTGTCGCCTGAGTGCCTGGATGGAGCCCAGCACTTCCTAAAAGATGATGGTGTGAGCATCCCCGGGGA
GTACACTTCCTTTCTGGCTCCCATCTCTTCCTCCAAGCTGTACAATGAGGTCCGAGCCTGTAGGGAGAAG
GACCGTGACCCTGAGGCCCAGTTTGAGATGCCTTATGTGGTACGGCTGCACAACTTCCACCAGCTCTCTG
CACCCCAGCCCTGTTTCACCTTCAGCCATCCCAACAGAGATCCTATGATTGACAACAACCGCTATTGCAC
CTTGGAATTTCCTGTGGAGGTGAACACAGTACTACATGGCTTTGCCGGCTACTTTGAGACTGTGCTTTAT
CAGGACATCACTCTGAGTATCCGTCCAGAGACTCACTCTCCTGGGATGTTCTCATGGTTTCCCATCCTCT
TCCCTATTAAGCAGCCCATAACGGTACGTGAAGGCCAAACCATCTGTGTGCGTTTCTGGCGATGCAGCAA
TTCCAAGAAGGTGTGGTATGAGTGGGCTGTGACAGCACCAGTCTGTTCTGCTATTCATAACCCCACAGGC
CGCTCATATACCATTGGCCTCTAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_006109 unedited
GTTCANAATTGTATACGACNACTATAGGCGGCNCGCGAATCGGCACCAGGCCTCGTGCCG
AATTCGGCACGAGGAGATGGCGGCGATGGCGGTCGGGGGTGCTGGTGGGAGCCGCGTGTC
CAGCGGGAGGGACCTGAATTGCGTCCCCGAAATAGCTGACACACTAGGGGCTGTGGCCAA
GCAGGGGTTTGATATCCTCTGCATGCCTGTCTTCCATCCGCGTTTCAAGAGGGAGTTCAT
TCAGGAACCTGCTAAGAATCGGCCCGGTCCCCAGACACGATCAGACCTACTGCTGTCAGG
AAGGGACTGGAATACGCTAATTGTGGGAAAGCTTTCTCCATGGATTCGTCCAGACTCAAA
AGTGGAGAAGATTCGCAGGAACTCCGAGGCGGCCATGTTACAGGAGCTGAATTTTGGTGC
ATATTTGGGTCTTCCAGCTTTCCTGCTGCCCCTTAATCAGGAAGATAACACCAACCTGGC
CAGAGTTTTGACCAACCACATCCACACTGGCCATCACTCTTCCATGTTCTGGATGCGGGT
ACCCTTGGTGGCACCAGAGGACCTGAGAGATGATATAATTGAGAATGCACCAACTACACA
CACAGAGGAGTACAGTGGGGAGGAGAAAACGTGGATGTGGTGGCACAACTTCCGGACTTT
GTGTGACTATAGTAAGAGGATTGCAGTGGCTCTTGAAAATGGGCTGACCTCCCATCTAAT
CATGTCATTGATCGCTGGCTTGGGGAGCCCATCANAGCAGCCATTCTCCCCACTAGCATT
TTCCTGACCAAATAGAAGGNNATTCCTGNTNNCTTCTAGATGCACCAGAGGCTCATCTTT
CCGCTCCTCAGNTGGAGGTGCAGTTCATCATCACAGGCACAACCACACTCAGANAAGGAG
GTCTGCTCCTACCTCCATA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006109 unedited
CCGCGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTGGCGGGCAGTAAAGGGCTATAACTTTATTTGTATTTCCTCTTACCCAAAACCCTTAA
AACAAGAACCGAAAAAGGGTGAAAATCCGTTCAAACCCCATGTTCTCAGGGATATTCCAG
GGAGTTCTTGAGGGTGAGTGCGTAACTTTAAATCCAGCACTAATTCCTCACCCCCTGGCC
TGAGGGCTTCATAAATTGGGGGCTTGAACCCTGCAATTAATTATAATCCCTTGCCCACCT
TGATGTAAGGCAGGAAAGCAAATTGAAATGCTCCTCTCTGATGGGCAAGGGGAATCACAG
CCCATAAATGTACTGCACCTTTTGTACTACAGGAACAAAACCTGAAGCTGCTTTCAAGGG
TCTGGACACTTGGCACGCAGGGCTAAAGGCCAATGGTATATGAACGGCCTGTGGGGTTAT
GAATAACAAAACAGACTGGTGCTTGTACAACCCACTCATACCACACCTTTTTGGAAATGC
TGGCTCGCCAAAAACCCCCACAGATGGGTTGGGCCTTACGTACCCGTATTGGCTGCTTAA
TAAGGAAGAAGATGGGAAACCATTAAAACCTTCCAGGAAAGTGAGTTTCTTGACGGCTAC
CTCCGATGGATGCCTCGATAAACCCAGTCCCAAGGTACCCCGGAAAAGCCTGTGTATCTG
GGTTACCTCCACAGAAATTCCAAGGCAAAACGGGGTGTCGCCATATAGGAACCTTGTGGG
TAGGCTGAAGGAAAACACGGCTGGGGTCAAAAACTTGTGGAAATTCGCACCCCACACCTT
AAGGGTCTTAAAAGGGCCCTAGGTACGGGGCTTCTCTACAGGTGGACTTATTGTAACTTG
GGGAAAACGGACCCCAAGAATGTCTCCCGGT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006109
ORF Size 2541 bp
Insert Size 2500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006109.2, NP_006100
RefSeq Size 2541
Locus ID 10419
Cytogenetics 14q11.2
Domains Skb1
Protein Families Stem cell - Pluripotency
Gene Summary This gene encodes an enzyme that belongs to the methyltransferase family. The encoded protein catalyzes the transfer of methyl groups to the amino acid arginine, in target proteins that include histones, transcriptional elongation factors and the tumor suppressor p53. This gene plays a role in several cellular processes, including transcriptional regulation, and the assembly of small nuclear ribonucleoproteins. A pseudogene of this gene has been defined on chromosome 4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015].
Transcript Variant: This variant (1) encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations